ID: 1021489459

View in Genome Browser
Species Human (GRCh38)
Location 7:21202864-21202886
Sequence GGAAAATGATTCTGGTGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021489456_1021489459 21 Left 1021489456 7:21202820-21202842 CCATCAGAGGTTTTTAAACGGTG No data
Right 1021489459 7:21202864-21202886 GGAAAATGATTCTGGTGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021489459 Original CRISPR GGAAAATGATTCTGGTGTAC AGG Intergenic
No off target data available for this crispr