ID: 1021491660

View in Genome Browser
Species Human (GRCh38)
Location 7:21225723-21225745
Sequence GAATTTAATGGACCATGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021491660_1021491666 18 Left 1021491660 7:21225723-21225745 CCACCACATGGTCCATTAAATTC No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021491660 Original CRISPR GAATTTAATGGACCATGTGG TGG (reversed) Intergenic
No off target data available for this crispr