ID: 1021491661

View in Genome Browser
Species Human (GRCh38)
Location 7:21225726-21225748
Sequence GGGGAATTTAATGGACCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021491661_1021491666 15 Left 1021491661 7:21225726-21225748 CCACATGGTCCATTAAATTCCCC No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021491661 Original CRISPR GGGGAATTTAATGGACCATG TGG (reversed) Intergenic
No off target data available for this crispr