ID: 1021491663

View in Genome Browser
Species Human (GRCh38)
Location 7:21225745-21225767
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021491663_1021491666 -4 Left 1021491663 7:21225745-21225767 CCCCTGACACTTGTTGAACTTAA No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data
1021491663_1021491670 14 Left 1021491663 7:21225745-21225767 CCCCTGACACTTGTTGAACTTAA No data
Right 1021491670 7:21225782-21225804 GTAGGAGAAAACAACCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021491663 Original CRISPR TTAAGTTCAACAAGTGTCAG GGG (reversed) Intergenic
No off target data available for this crispr