ID: 1021491666

View in Genome Browser
Species Human (GRCh38)
Location 7:21225764-21225786
Sequence TTAAACAAACAACCCCGAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021491663_1021491666 -4 Left 1021491663 7:21225745-21225767 CCCCTGACACTTGTTGAACTTAA No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data
1021491661_1021491666 15 Left 1021491661 7:21225726-21225748 CCACATGGTCCATTAAATTCCCC No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data
1021491662_1021491666 6 Left 1021491662 7:21225735-21225757 CCATTAAATTCCCCTGACACTTG No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data
1021491664_1021491666 -5 Left 1021491664 7:21225746-21225768 CCCTGACACTTGTTGAACTTAAA No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data
1021491660_1021491666 18 Left 1021491660 7:21225723-21225745 CCACCACATGGTCCATTAAATTC No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data
1021491665_1021491666 -6 Left 1021491665 7:21225747-21225769 CCTGACACTTGTTGAACTTAAAC No data
Right 1021491666 7:21225764-21225786 TTAAACAAACAACCCCGAGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021491666 Original CRISPR TTAAACAAACAACCCCGAGT AGG Intergenic
No off target data available for this crispr