ID: 1021491670

View in Genome Browser
Species Human (GRCh38)
Location 7:21225782-21225804
Sequence GTAGGAGAAAACAACCATTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021491665_1021491670 12 Left 1021491665 7:21225747-21225769 CCTGACACTTGTTGAACTTAAAC No data
Right 1021491670 7:21225782-21225804 GTAGGAGAAAACAACCATTCAGG No data
1021491663_1021491670 14 Left 1021491663 7:21225745-21225767 CCCCTGACACTTGTTGAACTTAA No data
Right 1021491670 7:21225782-21225804 GTAGGAGAAAACAACCATTCAGG No data
1021491662_1021491670 24 Left 1021491662 7:21225735-21225757 CCATTAAATTCCCCTGACACTTG No data
Right 1021491670 7:21225782-21225804 GTAGGAGAAAACAACCATTCAGG No data
1021491664_1021491670 13 Left 1021491664 7:21225746-21225768 CCCTGACACTTGTTGAACTTAAA No data
Right 1021491670 7:21225782-21225804 GTAGGAGAAAACAACCATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021491670 Original CRISPR GTAGGAGAAAACAACCATTC AGG Intergenic
No off target data available for this crispr