ID: 1021493498

View in Genome Browser
Species Human (GRCh38)
Location 7:21246593-21246615
Sequence AAGTGAGGAGCGCCTCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 27738
Summary {0: 600, 1: 9309, 2: 12337, 3: 4383, 4: 1109}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021493498_1021493508 -1 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493508 7:21246615-21246637 TCCCAGATGGGGTGGGGGCCGGG No data
1021493498_1021493507 -2 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493507 7:21246614-21246636 TTCCCAGATGGGGTGGGGGCCGG No data
1021493498_1021493504 -8 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493504 7:21246608-21246630 CCTCACTTCCCAGATGGGGTGGG No data
1021493498_1021493505 -7 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG No data
1021493498_1021493506 -6 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493506 7:21246610-21246632 TCACTTCCCAGATGGGGTGGGGG 0: 143
1: 1502
2: 3062
3: 3898
4: 2022
1021493498_1021493502 -9 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493502 7:21246607-21246629 TCCTCACTTCCCAGATGGGGTGG 0: 697
1: 4115
2: 10358
3: 4229
4: 3475
1021493498_1021493512 29 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493512 7:21246645-21246667 GCTCCTCACTTCCCAGACAGTGG 0: 29
1: 87
2: 275
3: 1582
4: 1185
1021493498_1021493513 30 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493513 7:21246646-21246668 CTCCTCACTTCCCAGACAGTGGG 0: 40
1: 103
2: 316
3: 1643
4: 1139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021493498 Original CRISPR AAGTGAGGAGCGCCTCTGCC TGG (reversed) Intergenic
Too many off-targets to display for this crispr