ID: 1021493505

View in Genome Browser
Species Human (GRCh38)
Location 7:21246609-21246631
Sequence CTCACTTCCCAGATGGGGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021493498_1021493505 -7 Left 1021493498 7:21246593-21246615 CCAGGCAGAGGCGCTCCTCACTT 0: 600
1: 9309
2: 12337
3: 4383
4: 1109
Right 1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021493505 Original CRISPR CTCACTTCCCAGATGGGGTG GGG Intergenic
No off target data available for this crispr