ID: 1021493505 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:21246609-21246631 |
Sequence | CTCACTTCCCAGATGGGGTG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1021493498_1021493505 | -7 | Left | 1021493498 | 7:21246593-21246615 | CCAGGCAGAGGCGCTCCTCACTT | 0: 600 1: 9309 2: 12337 3: 4383 4: 1109 |
||
Right | 1021493505 | 7:21246609-21246631 | CTCACTTCCCAGATGGGGTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1021493505 | Original CRISPR | CTCACTTCCCAGATGGGGTG GGG | Intergenic | ||
No off target data available for this crispr |