ID: 1021496830

View in Genome Browser
Species Human (GRCh38)
Location 7:21284232-21284254
Sequence CTATAGGCCATCTCTGCGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021496830_1021496834 -7 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496834 7:21284248-21284270 CCTATAGGCAGTAGCGTATAGGG No data
1021496830_1021496838 9 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496838 7:21284264-21284286 TATAGGGGAGGGTTTAGCACTGG No data
1021496830_1021496839 10 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496839 7:21284265-21284287 ATAGGGGAGGGTTTAGCACTGGG No data
1021496830_1021496837 -2 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496837 7:21284253-21284275 AGGCAGTAGCGTATAGGGGAGGG No data
1021496830_1021496835 -6 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496835 7:21284249-21284271 CTATAGGCAGTAGCGTATAGGGG No data
1021496830_1021496832 -8 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496832 7:21284247-21284269 GCCTATAGGCAGTAGCGTATAGG No data
1021496830_1021496836 -3 Left 1021496830 7:21284232-21284254 CCTATCGCAGAGATGGCCTATAG No data
Right 1021496836 7:21284252-21284274 TAGGCAGTAGCGTATAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021496830 Original CRISPR CTATAGGCCATCTCTGCGAT AGG (reversed) Intergenic
No off target data available for this crispr