ID: 1021496982

View in Genome Browser
Species Human (GRCh38)
Location 7:21286072-21286094
Sequence TTTTTATTATTGCCATCCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021496982_1021496984 5 Left 1021496982 7:21286072-21286094 CCCTTGGATGGCAATAATAAAAA No data
Right 1021496984 7:21286100-21286122 AACAATAACAAGTGCCTGTGAGG No data
1021496982_1021496986 20 Left 1021496982 7:21286072-21286094 CCCTTGGATGGCAATAATAAAAA No data
Right 1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021496982 Original CRISPR TTTTTATTATTGCCATCCAA GGG (reversed) Intergenic
No off target data available for this crispr