ID: 1021496984

View in Genome Browser
Species Human (GRCh38)
Location 7:21286100-21286122
Sequence AACAATAACAAGTGCCTGTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021496979_1021496984 28 Left 1021496979 7:21286049-21286071 CCACAATAGGACGACTTCACACT No data
Right 1021496984 7:21286100-21286122 AACAATAACAAGTGCCTGTGAGG No data
1021496982_1021496984 5 Left 1021496982 7:21286072-21286094 CCCTTGGATGGCAATAATAAAAA No data
Right 1021496984 7:21286100-21286122 AACAATAACAAGTGCCTGTGAGG No data
1021496983_1021496984 4 Left 1021496983 7:21286073-21286095 CCTTGGATGGCAATAATAAAAAA No data
Right 1021496984 7:21286100-21286122 AACAATAACAAGTGCCTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021496984 Original CRISPR AACAATAACAAGTGCCTGTG AGG Intergenic
No off target data available for this crispr