ID: 1021496986

View in Genome Browser
Species Human (GRCh38)
Location 7:21286115-21286137
Sequence CTGTGAGGATGTGAAGAAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021496982_1021496986 20 Left 1021496982 7:21286072-21286094 CCCTTGGATGGCAATAATAAAAA No data
Right 1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG No data
1021496983_1021496986 19 Left 1021496983 7:21286073-21286095 CCTTGGATGGCAATAATAAAAAA No data
Right 1021496986 7:21286115-21286137 CTGTGAGGATGTGAAGAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021496986 Original CRISPR CTGTGAGGATGTGAAGAAAT TGG Intergenic
No off target data available for this crispr