ID: 1021498782

View in Genome Browser
Species Human (GRCh38)
Location 7:21306471-21306493
Sequence GTTTCTCTAGCCTCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021498779_1021498782 27 Left 1021498779 7:21306421-21306443 CCTTTGCAAACATTGTGACAGCA No data
Right 1021498782 7:21306471-21306493 GTTTCTCTAGCCTCACAAGCTGG No data
1021498778_1021498782 30 Left 1021498778 7:21306418-21306440 CCACCTTTGCAAACATTGTGACA No data
Right 1021498782 7:21306471-21306493 GTTTCTCTAGCCTCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021498782 Original CRISPR GTTTCTCTAGCCTCACAAGC TGG Intergenic
No off target data available for this crispr