ID: 1021500518

View in Genome Browser
Species Human (GRCh38)
Location 7:21328353-21328375
Sequence TCTGCCACACAGAAAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021500515_1021500518 4 Left 1021500515 7:21328326-21328348 CCAATCAGATGTACTTTCAATTT No data
Right 1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG No data
1021500514_1021500518 25 Left 1021500514 7:21328305-21328327 CCTGATTGGTTGTGGGATGAACC No data
Right 1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG No data
1021500513_1021500518 29 Left 1021500513 7:21328301-21328323 CCAGCCTGATTGGTTGTGGGATG No data
Right 1021500518 7:21328353-21328375 TCTGCCACACAGAAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021500518 Original CRISPR TCTGCCACACAGAAAAAGGA GGG Intergenic
No off target data available for this crispr