ID: 1021503413

View in Genome Browser
Species Human (GRCh38)
Location 7:21354560-21354582
Sequence TGTCATAACCTGAATGGGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021503413_1021503416 -3 Left 1021503413 7:21354560-21354582 CCAAACCCATTCAGGTTATGACA No data
Right 1021503416 7:21354580-21354602 ACAGAGTACCCTACAGTTACAGG No data
1021503413_1021503419 25 Left 1021503413 7:21354560-21354582 CCAAACCCATTCAGGTTATGACA No data
Right 1021503419 7:21354608-21354630 AGTGCTTTCCATCTGAGATCTGG No data
1021503413_1021503420 26 Left 1021503413 7:21354560-21354582 CCAAACCCATTCAGGTTATGACA No data
Right 1021503420 7:21354609-21354631 GTGCTTTCCATCTGAGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021503413 Original CRISPR TGTCATAACCTGAATGGGTT TGG (reversed) Intergenic
No off target data available for this crispr