ID: 1021508250

View in Genome Browser
Species Human (GRCh38)
Location 7:21408615-21408637
Sequence ATGAGGAAGTAGAGGTATGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021508247_1021508250 13 Left 1021508247 7:21408579-21408601 CCTTCTCATGAAGGCTGAGGTCT No data
Right 1021508250 7:21408615-21408637 ATGAGGAAGTAGAGGTATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021508250 Original CRISPR ATGAGGAAGTAGAGGTATGA AGG Intergenic
No off target data available for this crispr