ID: 1021510524

View in Genome Browser
Species Human (GRCh38)
Location 7:21428088-21428110
Sequence TTTCCGCGAATGGCCGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 15
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 13}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021510524_1021510530 25 Left 1021510524 7:21428088-21428110 CCAGCGGCGGCCATTCGCGGAAA 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1021510530 7:21428136-21428158 AGCCTCCTCCGAGCCACCGCGGG 0: 1
1: 0
2: 0
3: 19
4: 135
1021510524_1021510533 29 Left 1021510524 7:21428088-21428110 CCAGCGGCGGCCATTCGCGGAAA 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1021510533 7:21428140-21428162 TCCTCCGAGCCACCGCGGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 88
1021510524_1021510532 28 Left 1021510524 7:21428088-21428110 CCAGCGGCGGCCATTCGCGGAAA 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1021510532 7:21428139-21428161 CTCCTCCGAGCCACCGCGGGCGG 0: 1
1: 0
2: 0
3: 9
4: 97
1021510524_1021510529 24 Left 1021510524 7:21428088-21428110 CCAGCGGCGGCCATTCGCGGAAA 0: 1
1: 0
2: 0
3: 1
4: 13
Right 1021510529 7:21428135-21428157 CAGCCTCCTCCGAGCCACCGCGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021510524 Original CRISPR TTTCCGCGAATGGCCGCCGC TGG (reversed) Exonic
915355002 1:155250621-155250643 TTTCCTCGAAGGGGCCCCGCAGG + Exonic
1096675044 12:53221704-53221726 TTTCCGGGAGTCGCCGCTGCTGG - Intronic
1106952754 13:34902748-34902770 TTTCAGCGAATGGCGGAGGCGGG + Intergenic
1129348103 15:74937566-74937588 TGACCGAGAGTGGCCGCCGCCGG - Intronic
1132588116 16:715032-715054 TTTCCGCCAATAGCAGGCGCGGG - Intronic
931654737 2:64500720-64500742 TTTCTGCAAATGGCAGCAGCTGG + Intergenic
942084011 2:172427780-172427802 CGTCCGCCCATGGCCGCCGCCGG + Exonic
965390224 3:168095520-168095542 TCTCCGCGAATGCCCGGGGCCGG + Exonic
1001442815 5:171758423-171758445 TTTCCCCTAATGGCCTCCACGGG + Intergenic
1002495273 5:179607397-179607419 TTTCCCCGTCTGGCCGCAGCCGG - Intronic
1021510524 7:21428088-21428110 TTTCCGCGAATGGCCGCCGCTGG - Exonic
1039454320 8:37697383-37697405 TTTGCGGGAGTCGCCGCCGCCGG - Exonic
1039967502 8:42293803-42293825 TTTCCTGGAATGGCCGGCGCTGG + Intronic
1040384434 8:46904597-46904619 TCTCTGCCAATGGCCGCCCCAGG - Intergenic
1195830566 X:109054116-109054138 TTTTCGCGAAGGCCCGCGGCGGG + Intergenic