ID: 1021514639

View in Genome Browser
Species Human (GRCh38)
Location 7:21470866-21470888
Sequence ATGGTGAAACAGACTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 0, 2: 2, 3: 38, 4: 343}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021514639 Original CRISPR ATGGTGAAACAGACTGAGGA TGG (reversed) Intronic
902185856 1:14724846-14724868 TTGATGAACCAGAGTGAGGAAGG - Intronic
902832887 1:19029188-19029210 TTGGTGAAACAAACTGTGGTTGG - Intergenic
902992756 1:20200792-20200814 ATGGAATCACAGACTGAGGATGG + Intergenic
904473590 1:30750748-30750770 ATGAGGAAACAGGCTCAGGAGGG - Intronic
906070578 1:43013507-43013529 ATGGTGACAAAGCCTGGGGATGG + Intergenic
906188364 1:43879238-43879260 ATGCTGTAACAGGGTGAGGAAGG + Intronic
908221489 1:62011267-62011289 ATGATGAAACTTAGTGAGGAAGG - Intronic
908565719 1:65354193-65354215 ATGGAGGAACAGAATGAGGTGGG + Intronic
908721546 1:67131614-67131636 ATGGTGGAACAGAAAGGGGAAGG - Intronic
909135359 1:71792421-71792443 TTGGTGAAACAGGATGAGAAGGG - Intronic
909169830 1:72281791-72281813 ATGGTATAAGAGAATGAGGAAGG + Intronic
909661016 1:78082150-78082172 ATGTGGAAACAGGCTCAGGAAGG + Intronic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
914220728 1:145679607-145679629 CTGGTGCAACAGAATGAGCATGG + Intronic
914473305 1:148002480-148002502 CTGGTGCAACAGAATGAGCATGG + Intergenic
914965016 1:152248630-152248652 ATGAGGAAACAGACTCAGAAAGG - Intergenic
915743435 1:158137813-158137835 AAAGTGAAAAAGACTGAGGGTGG - Intergenic
916598874 1:166273102-166273124 ATGGTGACTCAGAGTGGGGAAGG + Intergenic
917161713 1:172064474-172064496 AGGGTGACACAAACTGAGCAGGG + Intronic
917687307 1:177430410-177430432 ATGGTGAATCAGATTGCAGAGGG - Intergenic
918345179 1:183601565-183601587 ATGGTGAATCAGGCTGAGCACGG + Intergenic
918570483 1:185985779-185985801 ATGGAGACACAGAATGATGAAGG - Intronic
918849574 1:189668960-189668982 ATGGTTAAACTTAGTGAGGAAGG + Intergenic
919676778 1:200391740-200391762 TTGGGGAAACAAAATGAGGAAGG + Intergenic
919804459 1:201372894-201372916 CTCCTGAAACTGACTGAGGAAGG - Intronic
919837404 1:201584651-201584673 TTCTAGAAACAGACTGAGGAGGG - Intergenic
921080057 1:211732074-211732096 ATGGGGAAAGAGACAGAGGGAGG - Intergenic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921722568 1:218489583-218489605 ATAGTGAAGCACACTGAGCAGGG + Intergenic
923871186 1:237995745-237995767 ATGACAAAACAGACTGAGGTGGG - Intergenic
924606324 1:245538614-245538636 ATGGAGAGACAGACAGGGGAAGG - Intronic
1064041089 10:11964869-11964891 ATAATGAGACAGCCTGAGGATGG + Intronic
1064123128 10:12636647-12636669 ATGAGGAAACAGACTGAGAGGGG + Intronic
1064426273 10:15232425-15232447 ATGGCGAAACAAGCTGGGGAAGG - Intronic
1064697078 10:17978033-17978055 ATGGAAAAAGAGTCTGAGGATGG + Exonic
1066134934 10:32435942-32435964 ATGATTAAGCTGACTGAGGAAGG - Intergenic
1066252663 10:33649614-33649636 ATGGTGAACCATACTGAGACGGG - Intergenic
1066609345 10:37222656-37222678 ATGGAGGAACAGCATGAGGAAGG - Intronic
1067294167 10:44965226-44965248 CTGGTGAAACAGGCTATGGAAGG + Intronic
1068037227 10:51776034-51776056 GTGGGGAAACCGACTGAGAAAGG - Intronic
1068546428 10:58351614-58351636 ACGGTAAAACAGACTCAGGCAGG - Intronic
1070276064 10:75008147-75008169 ATGGTGATGCAGAGTGAGGATGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1071052229 10:81464903-81464925 ATGGTAAAACAGCCTCAGGCAGG - Intergenic
1072696173 10:97604619-97604641 ATGGTTAAACATACTGTGGGGGG - Intronic
1073793857 10:106966704-106966726 GTGGAGAAACAGAGTCAGGAGGG - Intronic
1074246401 10:111698059-111698081 AGGGTGAAAGAGAGTGAGAAGGG + Intergenic
1074438623 10:113455622-113455644 ATGGGGAAACAGACTCAGGATGG - Intergenic
1074540150 10:114358428-114358450 ATGAAGAAACAGACTCAGGGAGG + Intronic
1074541635 10:114370040-114370062 ATGGGGAAACAGAGTCAGGGAGG - Intronic
1075007142 10:118839337-118839359 ATGGTGACTCAGACTTAGGAGGG + Intergenic
1075345591 10:121679740-121679762 AGGGAGAGGCAGACTGAGGAGGG - Intergenic
1080691296 11:34560757-34560779 ATGAGGAAACAGACTCAGGCAGG + Intergenic
1080765962 11:35296957-35296979 ATGGTGAATAAGACAGAGAAAGG - Intronic
1083969726 11:66067500-66067522 GTGGTGAAACTGGCTGTGGATGG + Exonic
1085392286 11:76188675-76188697 ATGGGGAAACAGACACAGAAGGG + Intronic
1085520117 11:77132816-77132838 ATGATGAAACAGGCTCAGGAAGG + Intronic
1085557719 11:77440503-77440525 ATGAGGAAACAAACTGAGAAAGG + Intronic
1085902380 11:80716722-80716744 GAGGTGAAACAAACTGAGGTAGG + Intergenic
1085958698 11:81433378-81433400 ACTGTGAAACAGCCTGAGGCAGG - Intergenic
1087341053 11:96907732-96907754 ATGGTCAAAAACAGTGAGGAAGG + Intergenic
1089004126 11:115076650-115076672 AGGGTGAGACAGTTTGAGGAAGG - Intergenic
1089335222 11:117718245-117718267 AGGCTGACACAGCCTGAGGATGG + Intronic
1090284082 11:125483998-125484020 AATGTGAAAGAGAATGAGGATGG - Intronic
1090894160 11:130954625-130954647 ATTCTGATACAGAATGAGGATGG - Intergenic
1092815603 12:12310108-12310130 AAAGTGAAACAGATGGAGGAAGG + Intergenic
1098577875 12:72064504-72064526 ATGATTAAACTTACTGAGGAAGG + Intronic
1099821675 12:87719329-87719351 ATGAAGAAACAGACTCAGAAAGG - Intergenic
1100120586 12:91364888-91364910 CTACTGAAACAGACTGAGGGAGG - Intergenic
1100657167 12:96659592-96659614 ATGGAGAAATAGACTCATGAAGG + Intronic
1100826398 12:98478759-98478781 ATGATGAAACAGGCTTACGAAGG + Intergenic
1103963150 12:124621951-124621973 GGGGTGGAAGAGACTGAGGAAGG - Intergenic
1104073045 12:125363244-125363266 ATGGTGAAACATCCTGGGGCTGG - Intronic
1104369641 12:128212451-128212473 ATGGTCAGACAGACTCATGACGG - Intergenic
1104488405 12:129172481-129172503 ATGGTTAAGCTGAGTGAGGAAGG - Intronic
1104550045 12:129748347-129748369 ACGGAGAATGAGACTGAGGAGGG + Intronic
1104915031 12:132260167-132260189 ATGGAGAAACAGACACAGGGAGG + Intronic
1104948463 12:132427945-132427967 ATGGGGCAAGAGACTGAGGGCGG - Intergenic
1106202905 13:27557284-27557306 ATGATGAAACAAACTTAGGGAGG + Intronic
1106894076 13:34279193-34279215 AAGGTCAAAGAGACTTAGGAAGG + Intergenic
1108164858 13:47681835-47681857 ATGGTGAAGTAGACAGAGGAGGG + Intergenic
1108620749 13:52181718-52181740 CTGGGGAAACAGGCTGATGAAGG + Intergenic
1109752880 13:66719419-66719441 ATTATGAAAGAGATTGAGGAGGG + Intronic
1110087180 13:71394876-71394898 AAGATGAAACAAACTGGGGAAGG - Intergenic
1112699959 13:101996326-101996348 ATGGAGAAACTTTCTGAGGAGGG + Intronic
1112826362 13:103397155-103397177 ATGGTGAAACAGGCACAGAATGG + Intergenic
1112830772 13:103447595-103447617 ATTATCAAACAAACTGAGGAAGG - Intergenic
1113363351 13:109652311-109652333 GTGATGAAACAGACTGAGAAGGG - Intergenic
1114781291 14:25540955-25540977 ATGCTGAAAAGGAGTGAGGATGG + Intergenic
1115555613 14:34543005-34543027 ATGGTAGAGCAGACGGAGGAGGG - Intergenic
1115558295 14:34560088-34560110 ATGGTAGAGCAGACGGAGGAGGG + Intergenic
1116043469 14:39714466-39714488 ATGGTGCCACTCACTGAGGAAGG + Intergenic
1118636977 14:67756961-67756983 ATGGAGACACAGACTGAGAAAGG - Intronic
1119473602 14:74914069-74914091 ATGGAGAAACAGGCTCAGGAGGG - Intronic
1120299476 14:82688166-82688188 CTGGTGAGACAGAATGAAGAAGG + Intergenic
1120997976 14:90431097-90431119 AATGTGAAACAGTGTGAGGAAGG - Intergenic
1122444147 14:101757010-101757032 CTAGTGACACAGACAGAGGAGGG + Intergenic
1124101514 15:26698612-26698634 ATGATAAAACAGAATGAAGAGGG + Intronic
1124338306 15:28873612-28873634 ATGGTAGAAGAGACTGAGGAAGG + Intergenic
1125881834 15:43202055-43202077 ATGAGGAAACTTACTGAGGAGGG - Intronic
1126178946 15:45766072-45766094 GTTGTGATACAAACTGAGGACGG - Intergenic
1126326112 15:47479333-47479355 ATAGAGAAACAGGTTGAGGATGG - Intronic
1126374812 15:47986810-47986832 GTGGTGAAACAAAGTGAGGCAGG + Intergenic
1126395595 15:48213202-48213224 AAGGGAAAGCAGACTGAGGATGG - Intronic
1126544777 15:49861497-49861519 ATGCTGAGAGAGACTGAGGTAGG - Intronic
1127755032 15:62083935-62083957 AGTGTGAAACAGACTGAAGAAGG + Intergenic
1131442547 15:92469871-92469893 ATGGTGAGGAAGACTGAGAAAGG - Intergenic
1131610450 15:93955695-93955717 ATGGTGAAACTGAGTCAGGCAGG - Intergenic
1132001979 15:98189842-98189864 ATAGGGAAACAGACTTAGCAAGG + Intergenic
1133162380 16:3920584-3920606 ATGGAGAAGCAGGCAGAGGACGG - Intergenic
1133547154 16:6818709-6818731 CTGATGACACAGACTGAGGGTGG - Intronic
1133601581 16:7345028-7345050 GTGGTGACAAAGGCTGAGGAAGG + Intronic
1134316831 16:13126646-13126668 GTGGAGAGAGAGACTGAGGAAGG + Intronic
1135510063 16:23074939-23074961 ATGCTGGAACAGACTCAGGATGG + Intronic
1138318600 16:56091478-56091500 GAGGTGAAACAGGGTGAGGAGGG + Intergenic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138488403 16:57361483-57361505 ATGGAGAAACAGGCTTAGCAAGG + Intronic
1138589032 16:57989632-57989654 ATGATGAAATGGACTCAGGAAGG + Intergenic
1138858638 16:60727489-60727511 ATGGTGAAACAGAGAGAGAGTGG - Intergenic
1140455309 16:75101951-75101973 AGGGTGACACAAACTGAGAAGGG - Intronic
1141286379 16:82676329-82676351 ATGGTGCCACAGAATGAGGTAGG - Intronic
1141867696 16:86762059-86762081 ATGGAAAATCAGAATGAGGAAGG + Intergenic
1142784584 17:2210585-2210607 ATGGGGAAAGAGAAAGAGGAGGG + Intronic
1143367435 17:6417323-6417345 ATGGAGAAAGAGGCTGAGCAAGG + Intronic
1144753018 17:17663103-17663125 AGGGGGAAACAGGCTGAGAAAGG + Intergenic
1145051540 17:19665876-19665898 ATGGAGCAACTGACTTAGGACGG - Intronic
1148144343 17:45353216-45353238 AAGGGGAAACACACTGAGGAGGG - Intergenic
1148386770 17:47239801-47239823 AGGGTGAGGCAGACAGAGGATGG + Intergenic
1151126394 17:71849816-71849838 ATGGAGAAACAGACATAGAAAGG + Intergenic
1152366034 17:79856996-79857018 ATGGTAGAAGAGACTGAAGAGGG + Intergenic
1153071382 18:1109175-1109197 CTGTTGAAACAAACTGATGAGGG + Intergenic
1153802031 18:8679825-8679847 AGGGTGAAAGGGACTCAGGAAGG + Intergenic
1154953151 18:21229517-21229539 ATGATTAAACTTACTGAGGAAGG - Intergenic
1155084817 18:22447589-22447611 ATATTGAAACAGACAGAGAATGG - Intergenic
1156127240 18:33921096-33921118 ATGGTGGGACAGACATAGGATGG - Intronic
1156615488 18:38778725-38778747 ATTGTGAAAAAGAATGAGCATGG + Intergenic
1156659665 18:39332124-39332146 ATGGTCAAAAAGACTAATGAAGG - Intergenic
1156711567 18:39953160-39953182 ATGGTTAAACTTAGTGAGGAAGG - Intergenic
1157210804 18:45740385-45740407 ACGCTGAATCAGACTGAGGAGGG - Intronic
1157267810 18:46243911-46243933 ATGCTGAAGTAGACTGAGTAAGG + Intronic
1157616548 18:48990853-48990875 ATGGTGACACATACCGAGCATGG - Intergenic
1158140951 18:54255100-54255122 ATGGTGAAATAGATTGTGCAGGG - Intergenic
1158260129 18:55597416-55597438 ATGGTTAAAAAGGCTGAGGTGGG + Intronic
1162531590 19:11239352-11239374 ATGGAGAAACAGGCTCAGCATGG + Intronic
1162843769 19:13375463-13375485 ATGATTAAACACAGTGAGGAAGG + Intronic
1165650272 19:37481840-37481862 GAGGTCAAACAGACTGTGGAAGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167276977 19:48544898-48544920 AAGGTGACAGAGACTGGGGAGGG - Intergenic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
925560033 2:5181732-5181754 ATGTTAAAACAAACTGAGGAGGG + Intergenic
925587293 2:5476204-5476226 ATGATGAAAGAGACAGAGGTTGG + Intergenic
926173709 2:10570278-10570300 ATGGTGAGACAGGAGGAGGAAGG + Intergenic
926893104 2:17655227-17655249 ATGATGAAAATGAATGAGGATGG + Exonic
926932326 2:18052945-18052967 ATGGTGAAAAAGAGTGATGGTGG + Intronic
928422062 2:31145283-31145305 AAGGTGAAATAGCCAGAGGATGG - Intronic
928432567 2:31233243-31233265 AAGGTGAAAGAGAGTGAGGGAGG - Intronic
928842806 2:35631196-35631218 ATGGTGAACTAGACCCAGGAAGG + Intergenic
929834478 2:45382489-45382511 ATGGGGTAACAGAGGGAGGAAGG - Intergenic
930352057 2:50269093-50269115 ATGGGGAAACAGACTTAGACAGG + Intronic
930675001 2:54191068-54191090 ATGATGACTCAGGCTGAGGAGGG - Intronic
930739405 2:54814531-54814553 AGGGTGAGAGAGACAGAGGAAGG - Intronic
931030237 2:58167412-58167434 ATGTAGAAACAGACAGAGAAAGG - Intronic
931601345 2:64006467-64006489 ATTAGGAAACAGACTTAGGAAGG - Intronic
931925838 2:67071538-67071560 GTGGTGAAAGAGAGTGAGGAAGG - Intergenic
932443416 2:71754034-71754056 ATGGTGAAACAGCCTCAAGCAGG + Intergenic
932737459 2:74264269-74264291 ATTGAGAAGCAGATTGAGGATGG - Exonic
933322578 2:80795585-80795607 ATTGTTAACCAGTCTGAGGAAGG + Intergenic
936427574 2:112434180-112434202 ATGGAGAAACTGACAGAGAAGGG - Intronic
937270736 2:120649953-120649975 AGGGTCAAACAGATTGAGGCAGG - Intergenic
938211867 2:129473155-129473177 TTGCTGAAAGAAACTGAGGAAGG - Intergenic
938665502 2:133531155-133531177 ATGGTGAAAGGGAATGAGGAAGG + Intronic
938758405 2:134401397-134401419 ATGATGTAGCAGACTCAGGAAGG - Intronic
939182629 2:138821901-138821923 ATTGTGAAACAAACTGAGTATGG - Intergenic
939519368 2:143210289-143210311 TTTGGGAAACAGGCTGAGGAAGG - Intronic
940828890 2:158445408-158445430 ATTGTGATTCAGACTGAGAAAGG - Intronic
941023161 2:160431531-160431553 ATTATGAAACAGACTTTGGAAGG - Intronic
942058814 2:172208997-172209019 ATTGTGAAACAGCCTAAAGAAGG + Intergenic
942832516 2:180253719-180253741 ACTGTGAGACAGACTGAGGCTGG - Intergenic
943114548 2:183650469-183650491 ATAGTGAAAAAGACTCAAGAAGG + Intergenic
943784232 2:191859467-191859489 AGGGAGAGAAAGACTGAGGATGG - Intergenic
943986942 2:194635109-194635131 ATGGTAAAAAAGATTGAAGATGG - Intergenic
944586976 2:201181141-201181163 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
947029942 2:225782598-225782620 AGGGAGAAACAGAGGGAGGAAGG - Intergenic
947754165 2:232549794-232549816 ATGATTAAACTGAGTGAGGAAGG - Exonic
947755140 2:232557354-232557376 AAGGTGAATGAGACTGTGGAAGG + Intronic
947821471 2:233074235-233074257 GTGGTGAGACACACAGAGGATGG + Intronic
947835739 2:233173971-233173993 AGGCTGAAACAGGCTCAGGATGG + Intronic
1168862206 20:1053687-1053709 AGGAGGAAACAGGCTGAGGAGGG - Intergenic
1168862414 20:1055287-1055309 ATGGTGACAGGGACTGAGAAAGG - Intergenic
1169294485 20:4381980-4382002 ATGGGAAAACAGGCTGAGAATGG - Intergenic
1169512973 20:6284856-6284878 AAAGTCAAACAGAGTGAGGAAGG + Intergenic
1170381804 20:15769022-15769044 ATTGTAAAACAGCCTCAGGAAGG - Intronic
1171451410 20:25238530-25238552 GTAGTGACACAGGCTGAGGAAGG + Intergenic
1172612544 20:36262586-36262608 CTGGTGCTCCAGACTGAGGAAGG - Intronic
1173026549 20:39312663-39312685 AGGGTGTAACAAAGTGAGGAAGG - Intergenic
1173693595 20:44986417-44986439 TTGTTGAAACAGATTGAGCAAGG + Intronic
1175592953 20:60207789-60207811 TTGGTGAAAATGACTGGGGAGGG + Intergenic
1175987404 20:62770848-62770870 ATGGGGAAACAGGCTGGGAAAGG + Intergenic
1176374657 21:6081024-6081046 ATGGAGAAACTGACAGAGAAGGG + Intergenic
1179388305 21:40963141-40963163 AAGGAGGAAGAGACTGAGGAAGG + Intergenic
1179748818 21:43457221-43457243 ATGGAGAAACTGACAGAGAAGGG - Intergenic
1181296716 22:21846024-21846046 ATGGGGAAACAGACCTAGGCAGG + Intronic
1181296783 22:21846694-21846716 ATGGGGAAACAGACCTAGGCAGG - Intronic
1182111857 22:27729396-27729418 ATGGGGAAACAGACTCAGAAAGG - Intergenic
1182201517 22:28575669-28575691 CTGGTGAAAGAAACTGAAGAGGG - Intronic
1182379460 22:29875070-29875092 ACGATGAAACAAACTGAAGAAGG - Intergenic
1182414078 22:30209883-30209905 CTGATGGAAAAGACTGAGGATGG + Intergenic
1182554271 22:31120520-31120542 ATGCTGAAACAGGCTGAGGGTGG - Intergenic
1182737619 22:32542088-32542110 ATGGGGGAACAGACTGTGGAGGG + Intronic
1182891091 22:33819480-33819502 TTGGTGAAACAGCCTGTGGATGG - Intronic
1183004744 22:34891774-34891796 ATGGGCACACAGACTGAGGGTGG - Intergenic
949268783 3:2190156-2190178 CTAGTGGAACAGACTGAGCAGGG - Intronic
949465387 3:4338161-4338183 AAGGTGAAGCAGGCGGAGGATGG + Intronic
953678381 3:45021073-45021095 ATGGAGAACCACGCTGAGGAGGG - Intronic
954288858 3:49638402-49638424 ATGGAGGAAGAGACTGAGGTTGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955914844 3:63896550-63896572 CTGAAGAAACAGATTGAGGAAGG - Intronic
956278225 3:67526946-67526968 ATGGTTAAACAAACTGTGGTAGG + Intronic
956647436 3:71470230-71470252 ATGAAGAAACAGGCTCAGGAAGG - Intronic
957403244 3:79743933-79743955 ATTGTAAAACAGCCTGAGGCAGG - Intronic
957866490 3:86031086-86031108 ATGAATAAACAGACTTAGGAAGG + Intronic
958689282 3:97442282-97442304 ATGCTAAAAGAGACTGAAGAGGG + Intronic
958795310 3:98700842-98700864 AGTCTGAAGCAGACTGAGGAAGG + Intergenic
958880831 3:99667052-99667074 ATGAAGAAACAGATTCAGGAAGG + Intronic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
961141960 3:124563303-124563325 AAGATGAAACTGACTCAGGAAGG - Intronic
961321490 3:126079494-126079516 ATGGAGAAACTGACACAGGATGG + Intronic
961398738 3:126618052-126618074 CTGGTGAAAGAAACTGAAGAAGG + Intronic
962672534 3:137723748-137723770 ATGGTGACACACACTTAGGTGGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
964936768 3:162098831-162098853 ATGGTGAAACTCTCTGAAGATGG + Intergenic
965581938 3:170277910-170277932 ATGGAGGAACAGACGTAGGAAGG - Intronic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966415637 3:179686909-179686931 TTGGTGAAAGAAACTGAGAAAGG - Intronic
967039162 3:185673533-185673555 ATGGTCACACAGACTGGGGGTGG + Intronic
969105178 4:4802000-4802022 ATTGTGAAACAGATTGGGCATGG + Intergenic
969966699 4:11003864-11003886 ATGGAGAAACAGGCTCAGGGAGG + Intergenic
970182392 4:13413342-13413364 ATGGTGACACAGACTTCTGAAGG + Intronic
970690056 4:18611849-18611871 AAGGTGAAAGGGAGTGAGGAAGG + Intergenic
971068370 4:23061117-23061139 AAGACAAAACAGACTGAGGAAGG - Intergenic
971497899 4:27287420-27287442 ATGGAGAAACACTCTGTGGATGG + Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
972099418 4:35394306-35394328 ATGATTAAACATAGTGAGGAAGG + Intergenic
972163423 4:36253326-36253348 AAGGAGAAACAGGGTGAGGAGGG - Intergenic
972926347 4:44013827-44013849 ATGGGGCCACAAACTGAGGATGG + Intergenic
972952353 4:44343151-44343173 ATGATTAAACATACTGAGGTAGG - Intronic
973816412 4:54623418-54623440 CTGCTGGAACAGAGTGAGGAAGG - Intergenic
974270326 4:59642542-59642564 ATGGTGAAACATTCTGAAAAAGG + Intergenic
976987274 4:91317434-91317456 AAGGTGAAAGAGAATGGGGAGGG - Intronic
977153382 4:93542639-93542661 ATGCTGAAAAAGTGTGAGGAGGG + Intronic
977287721 4:95129892-95129914 ATGGTGAAACAGATTGGAAAAGG + Exonic
977831360 4:101597466-101597488 AGGAAGAAACAAACTGAGGATGG - Intronic
979292411 4:118992290-118992312 CTGCTGAAACAGTCTGAGGAAGG + Intronic
979374086 4:119924054-119924076 ATTTTGAAACAGATAGAGGAGGG - Intergenic
980105542 4:128584848-128584870 TTGGAGAATTAGACTGAGGATGG + Intergenic
980879887 4:138699102-138699124 ATGGTGGAACAAACTGATTATGG + Intergenic
981320832 4:143389212-143389234 TTGGTTAAAAAGACAGAGGAAGG - Intronic
981454764 4:144940599-144940621 ATAGTGCAAGAGACTGAGAAGGG - Intergenic
982759321 4:159262043-159262065 ATGGGGAACCAGACACAGGATGG - Intronic
984677620 4:182568374-182568396 TTGGAGAAACAGAATGAGAAGGG + Intronic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
986285968 5:6359245-6359267 ATGGTTAAAAACACTGAGGCTGG + Intergenic
986832438 5:11595192-11595214 ATGGGAAAACAGGATGAGGAAGG + Intronic
987797260 5:22644195-22644217 ATGGTGAAGCATAGTGAAGAAGG + Intronic
988714051 5:33807111-33807133 TTGCTGAAACAGACAGAGAAAGG - Intronic
990048176 5:51460392-51460414 ATGGCAAAACACACTGTGGAAGG - Intergenic
992381856 5:76245322-76245344 ATGGAGAAACAGGCTGTGGAAGG + Intronic
993415731 5:87627766-87627788 AAAATGAAACAGAATGAGGAGGG + Intergenic
996058719 5:119009237-119009259 ATGCTGACTCAGACTGAGGATGG + Intergenic
997716006 5:136043613-136043635 ATGATGAAATTGGCTGAGGATGG + Intronic
997851603 5:137337962-137337984 ATAGAGAAACAGACTCAGGGAGG - Intronic
998182617 5:139956027-139956049 ATGCTGAGACAGGCAGAGGAAGG + Intronic
999730445 5:154473345-154473367 ATGGAGAAACAGACTCAGGGAGG - Intergenic
1000009695 5:157219700-157219722 ATGGTGAAATAGTCTGCAGAAGG - Intronic
1000017929 5:157294755-157294777 ATGGTAAAACAGCCTCAGCAGGG - Intronic
1000040528 5:157481499-157481521 ATGAGGAAACAGACTCAAGAGGG + Intronic
1001126814 5:169027051-169027073 ATGGGTAGACAGACTTAGGATGG + Intronic
1001621819 5:173093133-173093155 AGGGTGAAACAAAGAGAGGATGG + Intronic
1001880556 5:175240482-175240504 CTGGTGTCGCAGACTGAGGAGGG - Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002585802 5:180246657-180246679 AGGGTAAAAAATACTGAGGATGG + Intronic
1005423500 6:25677209-25677231 ATATTGGAAGAGACTGAGGAAGG - Intronic
1007159462 6:39777293-39777315 ATTGTGAAAGACCCTGAGGAGGG - Intergenic
1007607986 6:43130106-43130128 ATGGAGAAACGGCCTGAGGAAGG - Intronic
1007703193 6:43776148-43776170 ATGCTGAAACAGGCTGAAAAAGG - Intronic
1007898451 6:45386703-45386725 ATGGTTTAACAAAATGAGGAAGG + Intronic
1009994340 6:70881839-70881861 ATGGACAGACAGACAGAGGAGGG - Intronic
1010188149 6:73166134-73166156 ATGGTAAAACACACTCAGGCCGG + Intronic
1010294258 6:74177681-74177703 ATGGGGAAACAGACTTAGGGAGG - Intergenic
1010332112 6:74635350-74635372 AAGGTGAGAAAGAGTGAGGAAGG - Intergenic
1011336356 6:86265689-86265711 GAAGTGAAACAGACTGGGGAAGG - Intergenic
1012146834 6:95694587-95694609 ACCGTGAAAGAGACTGAGTATGG - Intergenic
1012338899 6:98093807-98093829 ATTGTGAAACCCACTGAGCAAGG + Intergenic
1014191037 6:118496965-118496987 ATCTTGAAACAGACTGAGCCAGG + Intronic
1015306408 6:131713530-131713552 ATGGTGAAAGAGACTCAGTCTGG + Intronic
1015519124 6:134114122-134114144 ATGCTGCAGCAGAGTGAGGAGGG - Intergenic
1016060417 6:139624002-139624024 ATAGTGAGAAAGACTGAGGAAGG + Intergenic
1016989622 6:149920215-149920237 ATGGTGGGACGGAGTGAGGATGG + Intronic
1016993429 6:149944877-149944899 CTGGTTGAACAGAGTGAGGATGG - Intronic
1017004904 6:150022653-150022675 CTGGTTGAACAGAGTGAGGATGG + Intronic
1018157572 6:161001754-161001776 ATGCGGAAACAGACTGAGAGAGG - Intronic
1019026649 6:168971279-168971301 ATGGTGGAACAGACATAGCATGG + Intergenic
1019049237 6:169170399-169170421 ATGGTGAACCAGACAGGGCAGGG - Intergenic
1019668791 7:2267094-2267116 ATGGAGAAACAGGCTCAGGGAGG - Intronic
1019834639 7:3370674-3370696 CTGGTGAAACAGATTGCGAATGG + Intronic
1019850040 7:3545663-3545685 ATGCTGAACCAGCCAGAGGATGG - Intronic
1021280259 7:18708282-18708304 ATGGAGAAAAAGAGGGAGGAAGG + Intronic
1021514639 7:21470866-21470888 ATGGTGAAACAGACTGAGGATGG - Intronic
1022816855 7:33922249-33922271 ATGGTAAAAAATACTAAGGATGG - Intronic
1023583117 7:41702463-41702485 ATGGTGAAAGAGAATGGGGGAGG + Intronic
1024633961 7:51271637-51271659 AAACTGAAAAAGACTGAGGAGGG + Intronic
1025294824 7:57769111-57769133 AAGGTGAAACACAGAGAGGAAGG - Intergenic
1026181997 7:68049735-68049757 ATGGTGAAACAGAATCATGTTGG + Intergenic
1026375487 7:69746411-69746433 ATGGTGATACATTCTGTGGAGGG + Intronic
1029444963 7:100606652-100606674 AAGGGGAAACAGACTGAAGGGGG + Intronic
1029629212 7:101739916-101739938 CTGTGCAAACAGACTGAGGAAGG - Intergenic
1031038963 7:116818587-116818609 ATGGTGTAACAGAATGAGATAGG + Intronic
1031339596 7:120582597-120582619 ATGGAGAAAGAGGCAGAGGAGGG - Intronic
1031732992 7:125320864-125320886 ATAGAGAAAGAGAGTGAGGAGGG - Intergenic
1031910961 7:127516264-127516286 ATGAAGAAACAGCCTGAGGAAGG - Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1033679606 7:143580974-143580996 ATGGTGAAAGAGACTCAGTCTGG + Intergenic
1033692230 7:143748469-143748491 ATGGTGAAAGAGACTCAGTCTGG - Intergenic
1033731141 7:144180970-144180992 ATGGTGAAAGAGACTCAGTCTGG - Intergenic
1033740521 7:144271762-144271784 ATGGTGAAAGAGACTCAGTCTGG + Intergenic
1034250477 7:149686594-149686616 AAGGTGAAACAGAGAGAGGGAGG + Intergenic
1036142127 8:6218261-6218283 CTTGTGAAACAGACTCATGAGGG + Intergenic
1037923091 8:22821683-22821705 AGGGAGAAAGAGGCTGAGGAGGG + Intronic
1038044608 8:23755536-23755558 ATTGTGAAACATCCAGAGGAGGG - Intergenic
1038129217 8:24710663-24710685 ATGGAGGAACAGAGTAAGGAGGG + Intergenic
1039109623 8:34027641-34027663 ATGGAGAGACAGACTGGTGAGGG - Intergenic
1039148290 8:34474768-34474790 ATGCTGGAACAGAATGAGTAAGG + Intergenic
1039337356 8:36606479-36606501 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic
1040061039 8:43102975-43102997 GGGGTGAAAGAGACTGAGGCTGG - Intronic
1040470799 8:47734438-47734460 ATGGCCAAAGAGACTGAGGCTGG - Intronic
1041569815 8:59324744-59324766 ATGCTGATACAGATTGAAGAGGG + Intergenic
1043975175 8:86577056-86577078 ATTGAGAAACAGACAGAGCAGGG - Intronic
1045542646 8:103101320-103101342 ATGGGCAGCCAGACTGAGGAGGG + Intergenic
1045833326 8:106490712-106490734 ATGGTGAGAAGGACTGAAGATGG + Intronic
1046489555 8:114932303-114932325 ATGTTGAAACAGAAAGAGGAGGG - Intergenic
1046790571 8:118317291-118317313 CTGGTGACACATACTCAGGATGG - Intronic
1047372907 8:124270813-124270835 AGGGTGGTACAGATTGAGGAAGG + Intergenic
1047547149 8:125829377-125829399 ATAGTGGATCAGACTGAGGTGGG - Intergenic
1048039210 8:130709173-130709195 ATGGAGAATTAGAATGAGGAGGG + Intergenic
1048459783 8:134611871-134611893 ATGTTGAAATACACTGAAGAGGG + Intronic
1048668442 8:136690326-136690348 ATGGTGTAACAGGCAGAGGCTGG - Intergenic
1048748504 8:137643585-137643607 ATGTTGAAAAGGAGTGAGGAAGG + Intergenic
1049939666 9:533350-533372 ATGGAAAAACAGACTTAGAAAGG - Intronic
1051154913 9:14131761-14131783 AGGCTGCTACAGACTGAGGAAGG - Intronic
1051491586 9:17672859-17672881 ATTCTGAAACAGAATGAGGCTGG - Intronic
1052691842 9:31825238-31825260 TTGGTGAAAGGGACTGTGGAGGG + Intergenic
1053055114 9:34989449-34989471 TTGGTGAAAAAGACAGAGGGCGG - Intergenic
1054853986 9:69878440-69878462 ATGCTGAAACAGAATCAGGCAGG - Intronic
1055040192 9:71862272-71862294 ATGTTGAAACCTAGTGAGGATGG - Intergenic
1056353547 9:85775838-85775860 ATGGTGCACCAGATTGAGGTTGG + Intergenic
1056405290 9:86268126-86268148 ACCGTGAAACAGCCTGAGGCAGG + Intronic
1056693254 9:88825750-88825772 ACGGTGAAACAGGCATAGGACGG - Intergenic
1057055135 9:91954588-91954610 ATGGTGATAGAGAGAGAGGACGG - Intergenic
1057928068 9:99170573-99170595 ATGGGGAAACAGGCTGAGAAAGG + Intergenic
1058635444 9:107033867-107033889 ATGAAGAAACAGACTAAGGAAGG - Intergenic
1059256826 9:112938513-112938535 ATGGAGAAACAGTCTTAGAAGGG - Intergenic
1059281485 9:113137881-113137903 ATGGTGAAGCAGTCAGAGGCAGG + Intergenic
1060412179 9:123407135-123407157 ATGATAAAACAGACAGAGCAGGG + Intronic
1061048043 9:128177992-128178014 ATGGGGAAACAGACTCAGGAGGG + Intronic
1061106282 9:128533131-128533153 ATGATGAAACAGGCTGGGCATGG + Intronic
1186115178 X:6297800-6297822 ATGTGGAAACAGAACGAGGAAGG + Intergenic
1186191793 X:7074002-7074024 ATGGTGAAACCCACAGAGCAAGG - Intronic
1186196724 X:7116535-7116557 ATGGTGAATGAGGCTGAGCAGGG - Intronic
1186730266 X:12402437-12402459 ATGGTGCAACTTACTGAGGTAGG - Intronic
1187768447 X:22668926-22668948 ATGGAGAAATAAACTGAGCAAGG - Intergenic
1188009536 X:25041592-25041614 ATGGAGACACAGAGAGAGGATGG - Intergenic
1189085353 X:38017535-38017557 ATGATGAAAGAGACTGAAGAGGG - Intronic
1189313022 X:40033224-40033246 ACGGTGAAACAGACAGAGCCAGG + Intergenic
1190762454 X:53447895-53447917 AATGTGAGAGAGACTGAGGAAGG - Intergenic
1192080246 X:68040809-68040831 ATGGAGAAACATACTGAGGGGGG - Intergenic
1192817826 X:74613464-74613486 ATGGTGAAACTGTCTAGGGAAGG + Intronic
1194812559 X:98403891-98403913 ATGGTTAAAGAGACTAAGCAAGG - Intergenic
1195009116 X:100718001-100718023 ATGGGGAAACAGACTCAAGGAGG - Intronic
1196410686 X:115414962-115414984 ATGATGAAACAGAATTGGGAAGG - Intergenic
1196748154 X:119090061-119090083 GTGGGGAAACTGACTGGGGAAGG + Intronic
1197117221 X:122848018-122848040 ATGGTGCAACAGAAAGAGCACGG - Intergenic
1197883944 X:131198431-131198453 ATTTTGAAACAAGCTGAGGAAGG - Intergenic
1198027011 X:132716949-132716971 ATGCTGACACAGACCAAGGATGG + Intronic
1198621337 X:138514068-138514090 ATGGTGAAGCTTAGTGAGGAAGG - Intergenic