ID: 1021515595

View in Genome Browser
Species Human (GRCh38)
Location 7:21481233-21481255
Sequence CAGACATCTTGCCCCTCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021515592_1021515595 -2 Left 1021515592 7:21481212-21481234 CCAGGGGTAAGATAAGAAATGCA 0: 1
1: 0
2: 1
3: 27
4: 166
Right 1021515595 7:21481233-21481255 CAGACATCTTGCCCCTCCTGGGG No data
1021515588_1021515595 20 Left 1021515588 7:21481190-21481212 CCTGGAACTTAGCAACAGGCAAC 0: 1
1: 0
2: 3
3: 11
4: 85
Right 1021515595 7:21481233-21481255 CAGACATCTTGCCCCTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021515595 Original CRISPR CAGACATCTTGCCCCTCCTG GGG Intronic
No off target data available for this crispr