ID: 1021517172

View in Genome Browser
Species Human (GRCh38)
Location 7:21501888-21501910
Sequence TACTCGGGACATCCTCAAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 2, 2: 1, 3: 6, 4: 46}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021517172 Original CRISPR TACTCGGGACATCCTCAAAG GGG (reversed) Intronic
903701764 1:25254109-25254131 TCCTTGGGACATCCTAAAAAAGG - Intronic
903763118 1:25713066-25713088 AACTCTGGCCAGCCTCAAAGGGG - Intronic
909113845 1:71509838-71509860 TACTTGGGATGCCCTCAAAGGGG + Intronic
910804085 1:91173351-91173373 TACCTGGGACCTACTCAAAGTGG - Intergenic
912861345 1:113216578-113216600 TCCTCTGAACATCCTCACAGTGG - Intergenic
1063496679 10:6515653-6515675 TACTCTGGACATTTTCAAAAAGG + Intronic
1072036249 10:91565603-91565625 TACCCAGGACACCCTCAAATGGG - Intergenic
1073599055 10:104829026-104829048 TGGTCAGGACATCCTCACAGTGG - Intronic
1085940552 11:81201532-81201554 TACTTGGGGCATCCTCAAAGGGG + Intergenic
1097471363 12:59996833-59996855 TACTCGTCACCTCCTCATAGAGG - Intergenic
1098967252 12:76803879-76803901 TACTTGGGATGCCCTCAAAGGGG + Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1109797922 13:67341139-67341161 CACTCAGGACACCTTCAAAGGGG - Intergenic
1111586950 13:90293302-90293324 TACTCTGGACACCCTCGAAGGGG + Intergenic
1139642198 16:68299984-68300006 TACTTAGGAAATCCTAAAAGAGG + Exonic
1144209178 17:13000332-13000354 TATTCTGGACATCCCCAATGGGG - Intronic
1144647242 17:16983504-16983526 AACACAGGACATCCTCAATGTGG + Intergenic
1146450930 17:32973312-32973334 TACTTGAGACACCCTCAAAGGGG + Intronic
1148464256 17:47855606-47855628 TACAGGGGACCTCCACAAAGAGG - Intronic
1157082060 18:44536038-44536060 TAGTAGGGACATCCTCAGATGGG - Intergenic
1158825961 18:61219921-61219943 TTCTCGGGTCATCCTGAATGTGG + Intergenic
1161284228 19:3460468-3460490 TACCGGGGACATCATTAAAGAGG + Intronic
1164854970 19:31513632-31513654 TCCTCGTGACATTCTCAAAAAGG + Intergenic
940873615 2:158880343-158880365 TACTAGGGACAACATCACAGGGG + Intergenic
943719011 2:191183260-191183282 TGCTCGGGTCATCCCCACAGAGG - Intergenic
949343006 3:3049735-3049757 TACTTGGGACATTCCCAGAGAGG - Intronic
950444342 3:13027554-13027576 TTCTAGAGACATTCTCAAAGTGG + Intronic
951076815 3:18403899-18403921 TAGTCAGGACATGCACAAAGGGG - Intronic
953810903 3:46112053-46112075 TACTCGGGACACCCTCAAAGGGG - Intergenic
956516302 3:70052224-70052246 TTCTGGGGACATTGTCAAAGTGG - Intergenic
963518742 3:146338781-146338803 TACTTGGGACACTCTCAAAAGGG + Intergenic
965757060 3:172038367-172038389 TACTGTGGAGCTCCTCAAAGGGG - Intergenic
970331743 4:14993510-14993532 TATTCTGTACATCCTCACAGAGG - Intergenic
982466842 4:155742490-155742512 TACTAAGTACATCCTCAAGGGGG + Intergenic
984142858 4:176024262-176024284 TATTCAGGACATCCTGATAGAGG + Intergenic
995489332 5:112673989-112674011 TACTGGGTACATACTCAAAGGGG - Intergenic
996655404 5:125928146-125928168 TACTCGGGACACCCTCAAAGTGG + Intergenic
999351968 5:150880631-150880653 TACTCTGGACAACTTAAAAGCGG - Intronic
1001923633 5:175620029-175620051 TTCTCTGCACATGCTCAAAGAGG - Intergenic
1010858507 6:80874051-80874073 AACTAGAGTCATCCTCAAAGTGG - Intergenic
1011823153 6:91276014-91276036 TAAATGTGACATCCTCAAAGAGG - Intergenic
1018976284 6:168569848-168569870 TAAACGGGACTTCCTCAAAGTGG - Intronic
1021517172 7:21501888-21501910 TACTCGGGACATCCTCAAAGGGG - Intronic
1025834279 7:65080829-65080851 AACGCGGGGCAGCCTCAAAGGGG + Intergenic
1025904051 7:65770349-65770371 AACGCGGGGCAGCCTCAAAGGGG + Intergenic
1042664346 8:71189775-71189797 TGCTAGGGACAGCATCAAAGGGG + Intergenic
1044247896 8:89970691-89970713 AACTAGGGACTTTCTCAAAGTGG - Intronic
1049808886 8:144554320-144554342 TACTCCTGACATCCCCAGAGAGG + Intronic
1055036961 9:71827762-71827784 TTCTCTTGACATCCTGAAAGGGG + Intergenic
1056559006 9:87713615-87713637 CACTCGCTCCATCCTCAAAGCGG + Intergenic
1061990303 9:134155053-134155075 GACTCGGGTCATCCTCAAAAGGG - Intronic
1187222041 X:17337355-17337377 TACTCGGGACATCTCAAATGAGG - Intergenic
1194065779 X:89260256-89260278 TAGCCGAGGCATCCTCAAAGGGG - Intergenic
1194993355 X:100568806-100568828 TACTTGGGATGCCCTCAAAGGGG - Intergenic
1196725403 X:118890718-118890740 TACTCAGGACGCCCTCAAAGAGG + Intergenic
1200719948 Y:6594382-6594404 TAGCCGAGGCATCCTCAAAGGGG - Intergenic