ID: 1021518295

View in Genome Browser
Species Human (GRCh38)
Location 7:21510806-21510828
Sequence AGAAGCAGGACTTAAACTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 284}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021518292_1021518295 2 Left 1021518292 7:21510781-21510803 CCAGCTTTTATTTCCAGTTCATA 0: 1
1: 0
2: 0
3: 26
4: 362
Right 1021518295 7:21510806-21510828 AGAAGCAGGACTTAAACTTCAGG 0: 1
1: 0
2: 0
3: 26
4: 284
1021518291_1021518295 22 Left 1021518291 7:21510761-21510783 CCAGTGGCTATTTACTTGCTCCA 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1021518295 7:21510806-21510828 AGAAGCAGGACTTAAACTTCAGG 0: 1
1: 0
2: 0
3: 26
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021518295 Original CRISPR AGAAGCAGGACTTAAACTTC AGG Intronic
901274534 1:7980915-7980937 CCAAGCAGTACTTAAACTCCTGG + Intronic
902166811 1:14579114-14579136 AGAGGCAGGATTTGAACTCCAGG - Intergenic
902192076 1:14770869-14770891 AGAAGCAGGAATTAACTTTGAGG + Intronic
902776641 1:18679184-18679206 TGAAGAAGGACTTAAACCTGGGG - Intronic
903289479 1:22298986-22299008 AGAAGGACCACTCAAACTTCAGG - Intergenic
903798370 1:25947531-25947553 CGAAGCTGGTCTTAAACTCCTGG - Intergenic
907024653 1:51104287-51104309 AAAAGCAGGACTTATAGTTCAGG + Intronic
909038080 1:70617776-70617798 AGAAGCAGGGATTAGAGTTCGGG + Intergenic
909805838 1:79873368-79873390 AGAAGCATGACTTAAAGTTGGGG + Intergenic
910392728 1:86761438-86761460 AGAGGCAAGACTAAAACTTGGGG + Intergenic
911254227 1:95615652-95615674 AACAGCAGGGCTTGAACTTCAGG - Intergenic
912388029 1:109282319-109282341 AGAAGCTGGAGTTAGATTTCAGG - Intronic
912577032 1:110681796-110681818 AGAACAAGGACTTAGACTGCTGG - Intergenic
912587047 1:110776599-110776621 AGAAGCATGAGGGAAACTTCTGG + Intergenic
912889650 1:113515664-113515686 AGAGGTAGGACTCAAAATTCAGG + Intronic
915675060 1:157521851-157521873 AGAAGTAGGACTTGAACTCCTGG - Intronic
918152883 1:181813721-181813743 AGAATCAGTCCTTAAATTTCAGG + Intergenic
918577813 1:186084974-186084996 AGAAGCAGGTATAAAACTTATGG - Intronic
920872730 1:209807444-209807466 ACATGCAGGACTTGAATTTCAGG - Intergenic
922628360 1:227076920-227076942 TGAGGCAGGAATTAGACTTCGGG - Intronic
922926219 1:229348902-229348924 AGACGCAGGTCTCAAACTTTAGG + Intergenic
923405417 1:233654572-233654594 AGAAGCAGCACTTAAAGATTTGG + Intronic
924798819 1:247312106-247312128 GGAAGCAGAACTTAAAGATCGGG - Intronic
1062976340 10:1686177-1686199 GGAAGCAGCACTTTAATTTCAGG + Intronic
1063131542 10:3182163-3182185 CCAAGCTGGTCTTAAACTTCTGG - Intergenic
1065668203 10:28085740-28085762 AGAATCAGGAATCAAACTTAAGG + Intronic
1066540266 10:36438916-36438938 CCAAGCTGGACTTAAACTCCTGG - Intergenic
1068754439 10:60635124-60635146 TGATTCAGGAGTTAAACTTCAGG + Intronic
1069249618 10:66251942-66251964 GGAACCAGGATTTAAACTCCAGG + Intronic
1069521839 10:69127905-69127927 CGAAGCTGGTCTTGAACTTCTGG + Intronic
1071907956 10:90195892-90195914 AGATGCTGGTCTTAAACTCCTGG - Intergenic
1072518826 10:96212522-96212544 AGAGCCAGGACCTAAACCTCTGG + Intronic
1072991339 10:100197310-100197332 AGAAGGAAGACTTAAACATGAGG - Intronic
1073757265 10:106593901-106593923 GGAAGCAGGACTAAGACTCCTGG - Intronic
1076531946 10:131150685-131150707 AGAAACAGGACTTCAACTTTGGG + Intronic
1077400318 11:2352460-2352482 AGAAGCAGAACTTAAAGGTTTGG - Intergenic
1077739426 11:4828971-4828993 AGAGGCAGCACTGAAACTCCCGG - Intronic
1079243288 11:18735780-18735802 AAAAGCTGGACTTAAACCTGAGG + Intronic
1079635213 11:22729429-22729451 AGAAGCATGACATAAACATATGG - Intronic
1079840668 11:25395418-25395440 CCAAGCAGGTCTTAAGCTTCTGG - Intergenic
1080195842 11:29607745-29607767 AGAAGCAGTGATTTAACTTCAGG + Intergenic
1081709331 11:45206853-45206875 AGAATCAGGATTTGAACTCCTGG + Intronic
1082091942 11:48097360-48097382 AAAAGCAGGACTCACATTTCAGG - Intronic
1082782286 11:57297278-57297300 AGAAGCAGAACTTAAAGATTAGG + Intergenic
1083813958 11:65121592-65121614 AGGAGCACGACTTGATCTTCCGG + Exonic
1084384587 11:68835194-68835216 AGTAGCAGCTGTTAAACTTCTGG - Intronic
1086860176 11:91916297-91916319 AGAAGCAGGATTTAAATATTTGG - Intergenic
1087932421 11:103993284-103993306 CCAGGCTGGACTTAAACTTCTGG + Intronic
1088358626 11:108968678-108968700 TGAAGCAGGACTTTGACTTCTGG - Intergenic
1091875207 12:3928109-3928131 AAAAGCAGATCTTAAACTTATGG - Intergenic
1091988327 12:4932462-4932484 AGAACCAGGACTTCCTCTTCTGG - Intergenic
1093695387 12:22154010-22154032 AGATGCAGGACGCACACTTCTGG + Intronic
1094434274 12:30403848-30403870 ATAAGTAGGACATAAACTTTGGG - Intergenic
1095181258 12:39149005-39149027 CCAAGCTGGTCTTAAACTTCTGG + Intergenic
1095540845 12:43307042-43307064 AGAACCAGGATTTAAACTCATGG + Intergenic
1098173018 12:67765461-67765483 AAAAGCATGACCTAAACTGCTGG - Intergenic
1099914000 12:88869100-88869122 AAAAGCTGGACTTAAATGTCAGG + Intergenic
1100189435 12:92175169-92175191 CCAAGCTGGACTCAAACTTCTGG + Intergenic
1102517126 12:113457233-113457255 GGAGGCAGGACTTAAAATTCCGG + Intergenic
1102673077 12:114636601-114636623 TGAAGCAGGACTTTAACTCCTGG - Intergenic
1102723421 12:115037278-115037300 AGAACCAGGACTCAAAATTCAGG + Intergenic
1104354156 12:128070706-128070728 CCAAGCAGGTCTTGAACTTCTGG + Intergenic
1104501437 12:129289800-129289822 CCAGGCTGGACTTAAACTTCTGG - Intronic
1104888310 12:132125113-132125135 TGAAGAAAGACATAAACTTCCGG + Intronic
1105256801 13:18748850-18748872 AGAAGCAGGGCTTAAAAGTTTGG - Intergenic
1105259474 13:18768217-18768239 AGAAGCAGGGCTTAAAAGTTTGG - Intergenic
1105262154 13:18787538-18787560 AGAAGCAGGGCTTAAAAGTTTGG - Intergenic
1106272432 13:28167507-28167529 GGAAGCAGGACTTAAAAATTTGG - Intronic
1106353706 13:28958934-28958956 ACAAGCTGGACTTATGCTTCTGG + Intronic
1107269495 13:38598509-38598531 AGATGCAGGACTTTTACATCAGG - Intergenic
1108489613 13:50968186-50968208 CCAGGCTGGACTTAAACTTCTGG - Intronic
1108567341 13:51713661-51713683 AGAGGCTGGTCTTGAACTTCTGG - Intronic
1109145184 13:58771081-58771103 AGTAGCAGGAATTATACCTCAGG + Intergenic
1110037218 13:70703217-70703239 AAAAGGAGGATTCAAACTTCAGG - Intergenic
1110200240 13:72841450-72841472 AAAAGAAGAAATTAAACTTCAGG - Intronic
1110534845 13:76639110-76639132 AGAAGCAGAAATTAAAGCTCTGG - Intergenic
1110581279 13:77131442-77131464 CCAAGCTGGACTTGAACTTCTGG - Intronic
1111070730 13:83163104-83163126 AAAAGAAGGACTGAAAATTCCGG - Intergenic
1111386989 13:87540098-87540120 AGAAGCAGGGCTGCAACTACAGG + Intergenic
1113712300 13:112475276-112475298 AGAAGGAAGACTTTGACTTCTGG - Intergenic
1115362289 14:32517535-32517557 AGAAGCAGGATATAATCTCCTGG - Intronic
1115522821 14:34250390-34250412 GGACTCAGGACTCAAACTTCAGG - Intronic
1116565242 14:46437416-46437438 GGAAGTAGGACTGAAATTTCAGG + Intergenic
1118168250 14:63359115-63359137 AGAACCAGGACTTAATCATTTGG + Intergenic
1118368912 14:65119453-65119475 CCAAGCTGGACTTAAACTCCTGG - Intergenic
1118477921 14:66135622-66135644 AGAAGTAGGATTTCCACTTCAGG - Intergenic
1120909938 14:89657055-89657077 ACAAGCTAGACTTAAACTCCTGG - Intergenic
1121485305 14:94310162-94310184 TGAAACAGGATTTAAATTTCTGG - Intronic
1121806184 14:96825590-96825612 ACAAACAGTACTGAAACTTCAGG + Intronic
1122285247 14:100647795-100647817 AGAAGCAGAACTTAAACAGTTGG + Intergenic
1123874526 15:24610221-24610243 AAAAGCAGGACTTAATCATCTGG + Intergenic
1124096448 15:26652879-26652901 GAAAGCAGGACTTAAACTTTAGG - Intronic
1125291576 15:38154312-38154334 AGAGGCAGGAATTAGTCTTCAGG - Intergenic
1126041146 15:44592354-44592376 AGAAGCTGAAGCTAAACTTCTGG - Exonic
1127715516 15:61645480-61645502 AGGAGCAGGACATGAACTTGGGG - Intergenic
1127838719 15:62811558-62811580 AGAACCAGGATTTGAACTTGAGG - Intronic
1127885709 15:63198365-63198387 AGAGTCAAGAATTAAACTTCTGG - Intronic
1127965687 15:63921239-63921261 ACAAGCAGGGAGTAAACTTCTGG + Intronic
1131772616 15:95755844-95755866 AGAATCATGGCTCAAACTTCTGG + Intergenic
1133383638 16:5351424-5351446 AAAGGCAGGATTTGAACTTCAGG + Intergenic
1135710712 16:24714664-24714686 GAAAGAAAGACTTAAACTTCTGG - Intergenic
1139076882 16:63462169-63462191 AGAAACAGGACTAAAACTCAAGG - Intergenic
1139262318 16:65606527-65606549 ATAAGTAGGAATTAAACTTATGG - Intergenic
1139784345 16:69379546-69379568 AGAAGCAGGTCTCAAATTTTTGG + Intronic
1141491937 16:84379650-84379672 AGCAGCAGTACTCAAACTCCAGG - Intronic
1143957475 17:10683536-10683558 AAAAGCAGGAAATAAACTGCAGG - Intronic
1144040724 17:11408632-11408654 AGAAGCTAGACATAAACTGCTGG + Intronic
1147294464 17:39470896-39470918 ATATGCAGGACTTCTACTTCTGG - Exonic
1150334139 17:64318190-64318212 CCAGGCAGGACTTAAACTCCTGG + Intergenic
1151808220 17:76420000-76420022 AGAAGCATGACATAACCTTGGGG + Intronic
1154424763 18:14263699-14263721 AGAAGCAGAGCTTAAACATATGG + Intergenic
1154426542 18:14276586-14276608 AGAAGCAGGGCTTAAAAGTTTGG + Intergenic
1154429286 18:14296177-14296199 AGAAGCAGGGCTTAAAAGTTTGG + Intergenic
1154431555 18:14312526-14312548 AGAAGCAGGGCTTAAAAGTCTGG + Intergenic
1154434239 18:14331829-14331851 AGAAGCAGGGCTTAAAAGTTTGG + Intergenic
1155292349 18:24354942-24354964 AGAGGCAGCACTTAACCATCAGG - Intronic
1155965402 18:32030909-32030931 ACAAGCTGGACTCAAACTCCTGG + Intronic
1158551194 18:58437750-58437772 AGAAACAGGATTCAAACTCCAGG + Intergenic
1158883314 18:61801836-61801858 AGAAGCTGGACTGAAACTTAAGG + Intergenic
1159314013 18:66747523-66747545 ACAAGCTGGCCTCAAACTTCTGG + Intergenic
1159938861 18:74390170-74390192 AGGAGCACGACTTGATCTTCCGG + Intergenic
1161993619 19:7699122-7699144 AAAAGCAGGACCTAGTCTTCTGG - Intronic
1163804035 19:19385499-19385521 GGGGGCGGGACTTAAACTTCGGG - Intergenic
1165277792 19:34769970-34769992 AGAGGCTGGATTTAAACTTCAGG - Intronic
928452587 2:31389566-31389588 GGATGCAGGACTTTCACTTCAGG - Intronic
929155352 2:38784028-38784050 AGAAGCAGTTCAGAAACTTCAGG + Exonic
929424856 2:41833834-41833856 AGATGCAGGACTTAAACAGATGG - Intergenic
931307184 2:61041117-61041139 ACAGGCTGGCCTTAAACTTCTGG - Intronic
931999349 2:67869761-67869783 AGAAGAAGAACTTGAACCTCAGG - Intergenic
932040818 2:68297355-68297377 CTAAGCTGGTCTTAAACTTCTGG - Intronic
932540916 2:72651244-72651266 AGAGCCAGGACTCAAAATTCAGG + Intronic
933470029 2:82710448-82710470 AGAAGCAGGAGTAAAAATTAGGG - Intergenic
937737614 2:125311798-125311820 TGAATGAGCACTTAAACTTCAGG - Intergenic
937863848 2:126733293-126733315 AGAAGCAGGACTTTTGCTCCAGG - Intergenic
939032689 2:137095297-137095319 AGAAACAGGACTTAAACCAAGGG - Intronic
939236744 2:139503972-139503994 GGAAGCAGGACTTAAAAATTTGG + Intergenic
940062737 2:149590404-149590426 AGAAGGGGGCCTCAAACTTCTGG + Intergenic
940868432 2:158839362-158839384 AGAAGTTGGACTTATACTTTTGG - Intronic
943509823 2:188810669-188810691 AGAAGAATGACTAAAACTTAGGG + Intergenic
943599536 2:189898351-189898373 ATAAGCTGTACTTAAAATTCAGG - Intronic
943737363 2:191371586-191371608 AGACTCAGGACCTAAACTCCAGG + Intronic
944054447 2:195508889-195508911 AGAAACAGGACTAATATTTCAGG - Intergenic
944137713 2:196417487-196417509 CCAAGCTGGACTCAAACTTCTGG + Intronic
944177053 2:196842219-196842241 AGAACCAGGATTTAAACTCCAGG + Intronic
944737591 2:202581855-202581877 CCAAGCAGGTCTTAAACTTCTGG - Intergenic
947375809 2:229493885-229493907 GGCAGCAGGATTTAAACTGCTGG + Intronic
948253691 2:236551094-236551116 AGAAGCAGGGCCTGAACTTGTGG - Intergenic
1169067625 20:2703063-2703085 TGAGGCTGGACTTGAACTTCTGG - Intronic
1169613559 20:7411912-7411934 ACAAGCAGGAATTAAACATTGGG - Intergenic
1173025620 20:39305095-39305117 AGAAGCAAGAGTCAAACTTCTGG - Intergenic
1173392841 20:42650225-42650247 AGAACCAGGACTTGAAATCCAGG + Intronic
1173665332 20:44758832-44758854 AGATGCAGGACTGGAGCTTCTGG + Intronic
1175068368 20:56310175-56310197 AGCAGCAGTTCTTAACCTTCTGG + Intergenic
1175092934 20:56519774-56519796 ACAGGCTGGTCTTAAACTTCTGG + Intronic
1175444081 20:59008280-59008302 GGAACAAGGACTGAAACTTCTGG - Intergenic
1175459687 20:59143106-59143128 TCAAGCTGGACTTCAACTTCTGG + Intergenic
1175535574 20:59708612-59708634 TGAAGCAGGACCTAAATATCTGG - Intronic
1176842793 21:13853895-13853917 AGAAGCAGGACTTAAAAGTTTGG - Intergenic
1176844587 21:13866827-13866849 AGAAGCAGAGCTTAAACATATGG - Intergenic
1176845479 21:13873242-13873264 AGAAGCAGGGCTTAAAAGTTTGG - Intergenic
1176847320 21:13886390-13886412 AGAAGCAGAGCTTAAACATATGG - Intergenic
1176848214 21:13892793-13892815 AGAAGCAGGGCTTAAAAGTTTGG - Intergenic
1179206395 21:39284268-39284290 ACAAGCTGGTCTTGAACTTCTGG - Intronic
1181008803 22:20028322-20028344 ACAGGCTGGACTTAAACTCCTGG + Intronic
1181675712 22:24450302-24450324 AGAAGCAGGTAACAAACTTCTGG - Intergenic
1183624839 22:38995536-38995558 AGACGCAGGACTCCAACTTCTGG - Intergenic
949176786 3:1073074-1073096 AGAATAAGGAGTTTAACTTCTGG - Intergenic
949936157 3:9117907-9117929 CCAGGCTGGACTTAAACTTCTGG - Intronic
950614806 3:14150008-14150030 AGAACCAGGATTTACAATTCAGG + Intronic
951326814 3:21312955-21312977 AGAAGCAGAACTTAAAAATTTGG + Intergenic
952186191 3:30971805-30971827 AGAAGCTGGAATTCAAATTCAGG + Intergenic
952681836 3:36102688-36102710 GGAACCAGGACTCAAACTTAGGG - Intergenic
953030525 3:39176966-39176988 CCAAGCAGGTCTTAAACTCCTGG - Intergenic
953969643 3:47337059-47337081 AGAAACTGGACTGGAACTTCTGG + Intronic
954311428 3:49771286-49771308 CCAAGCTGGACTTGAACTTCTGG - Intronic
955300580 3:57774958-57774980 GGCAGCAGGACTTAAATATCAGG - Intronic
955429563 3:58828578-58828600 ATAAGCAGGAGCTAAACATCAGG + Intronic
955977699 3:64493866-64493888 AGAAAAAGGACTTGAACCTCAGG + Intergenic
956355447 3:68387181-68387203 GAAAGCAGGACTAAAAGTTCTGG + Intronic
960567382 3:119147838-119147860 AGAACTAGGACTTAAAATGCAGG - Intronic
961007534 3:123414964-123414986 AGAAGCAGGATTTGAACATATGG + Intronic
961429871 3:126873901-126873923 AGAAGCGGGATTTAAACCTGAGG + Intronic
962494570 3:135926385-135926407 ACAAGCAGGCCTTACTCTTCAGG + Intergenic
962649390 3:137473377-137473399 AGAAGTAAGACTTACTCTTCAGG - Intergenic
962968503 3:140376540-140376562 AGAAGGAAGACTTAGAATTCTGG - Intronic
964429977 3:156595108-156595130 AGAAGCAGGAATGAAACTGATGG - Intergenic
965000248 3:162943863-162943885 AGAAGAAAGAATTAGACTTCGGG - Intergenic
965134072 3:164739723-164739745 AGATGCAGGACATAAAGTTAAGG - Intergenic
967227352 3:187304548-187304570 AGAAGCGGTACTTCATCTTCTGG + Intergenic
969608416 4:8213686-8213708 TGAAGCTGGTCTTAAACTCCTGG - Intronic
970068058 4:12121841-12121863 AGAACTAGGATTTAAACCTCAGG - Intergenic
972228859 4:37046812-37046834 AGAAGCAGTAATTAAACTTGTGG - Intergenic
972565766 4:40267798-40267820 AGCAGCAGCTCTTAAAATTCCGG - Intergenic
974244600 4:59298525-59298547 AGAAGTAAGACTTAAAATTATGG + Intergenic
974952486 4:68599831-68599853 AGCATTAGGACTTAGACTTCTGG - Intronic
975142366 4:70931336-70931358 AGAGGTAGGACTTAGACTTTAGG + Intronic
977065992 4:92316070-92316092 AGAAGCAGGAATCAGTCTTCTGG - Intronic
977160360 4:93626807-93626829 AAAAGCATAACATAAACTTCAGG + Intronic
978451640 4:108840394-108840416 AGAAGCATGAATTAGACTTTGGG - Intronic
979122332 4:116919739-116919761 AGAAGCAGGACATAAAAGTTTGG + Intergenic
979263398 4:118673549-118673571 AGAAGCTGGTCTCAAACTCCTGG - Intergenic
979588850 4:122453802-122453824 AGAAGAAGAACTCAAACCTCTGG - Exonic
982955993 4:161767010-161767032 AGAAACAGGAGCTAAACTTTGGG - Intronic
983176570 4:164595673-164595695 AGAAGCAGGACTTGTGGTTCGGG + Intergenic
984884434 4:184437617-184437639 GGAGGCAGGACTTGAACCTCAGG + Intronic
986609703 5:9553945-9553967 GGAAGCAGAACTTAAAGATCTGG - Intergenic
987785263 5:22491207-22491229 ATAAGCAGGAACTAAACATCGGG - Intronic
988372317 5:30387590-30387612 AGAAGAAGGACATAAGCTTTGGG - Intergenic
988690586 5:33568132-33568154 AGAAACAGGACTAAAATGTCAGG + Intronic
988802912 5:34713433-34713455 AGTAGCCGGTCTTGAACTTCTGG + Intronic
988817420 5:34848141-34848163 AGAACCAGGGCTGAAACTTTAGG + Intronic
988940642 5:36142238-36142260 AGAACCAGGACTAAAAAATCAGG + Intronic
990100897 5:52185229-52185251 TGAACGAGGAGTTAAACTTCAGG - Intergenic
990755012 5:59058793-59058815 AAAAGGAAGACTTAAACTTACGG - Intronic
992484859 5:77184768-77184790 CTAAGCTGGTCTTAAACTTCTGG - Intergenic
992600742 5:78396669-78396691 AGAAGCAAGACCTAAACTCCTGG + Intronic
993942853 5:94081925-94081947 AGAAGCAAGAAGTAGACTTCAGG + Intronic
994352188 5:98759083-98759105 AGAGGCTGGCCTTGAACTTCTGG + Intergenic
994655664 5:102590683-102590705 AGAATGAGGATTTAAACTTAAGG - Intergenic
994661083 5:102655150-102655172 AGAATCATGACTTAATTTTCTGG - Intergenic
994863348 5:105228656-105228678 AGAAGGAGGACTTGAAATTCTGG + Intergenic
995504213 5:112842313-112842335 AGAAACAGGACTTGTACTTGAGG - Exonic
995508495 5:112884594-112884616 ACAAGCTGGTCTCAAACTTCTGG + Intronic
996388247 5:122932426-122932448 TGAAGCTGGACTCAAACTCCTGG - Intronic
996408110 5:123126757-123126779 AGAAACAGGTGTAAAACTTCTGG - Intronic
996445747 5:123548247-123548269 AGAGGCTGGTCTTGAACTTCTGG - Intronic
996798316 5:127375140-127375162 AGTAAAAGGAGTTAAACTTCTGG - Intronic
997064729 5:130547369-130547391 TGAAGCAGGACCTAACCTCCTGG - Intergenic
999379024 5:151107040-151107062 AGAACCAGGACTCAAACCACAGG - Intronic
1000893999 5:166833020-166833042 CTAGGCAGGTCTTAAACTTCTGG + Intergenic
1005286146 6:24329010-24329032 AGAATCAGGATTTAAACTTAAGG + Intronic
1006172168 6:32099571-32099593 TGAAGCTGGACTTGAACTCCTGG + Intronic
1008079989 6:47183833-47183855 ATAAGTAGGAGTTAAACATCAGG - Intergenic
1009465731 6:63966624-63966646 AGGGGCAGGGATTAAACTTCAGG - Intronic
1010731705 6:79398110-79398132 AGAAGCAGAACTTTGAATTCTGG + Intergenic
1012220003 6:96638081-96638103 AGGTGCAGGACATAATCTTCTGG - Intergenic
1013816357 6:114103122-114103144 AGAAGAAGGCCTTAAAATGCAGG - Intronic
1015070067 6:129081647-129081669 GAAAAAAGGACTTAAACTTCTGG - Intronic
1015936275 6:138408225-138408247 GGAAGCAGAACTTAAACATCTGG - Intronic
1016596922 6:145814237-145814259 CGAAGGAGGAGTTAAACTTAGGG - Intronic
1016611219 6:145992007-145992029 AAAAGGAGGACTTATATTTCGGG - Intergenic
1017562724 6:155647489-155647511 AAAAGCAGGACATAAAACTCAGG + Intergenic
1017912322 6:158804427-158804449 ACAATCAAGACTTAGACTTCAGG - Intronic
1018215328 6:161520643-161520665 AGACCCAGGACTCAAACTTTAGG - Intronic
1018520873 6:164650014-164650036 CCAAGCTGGACTTAAACTCCGGG + Intergenic
1019825393 7:3280053-3280075 AGAAGGATGACATAAACATCAGG - Intergenic
1020722207 7:11761098-11761120 AGAAACAGCAGTTAATCTTCGGG - Intronic
1021518295 7:21510806-21510828 AGAAGCAGGACTTAAACTTCAGG + Intronic
1022957926 7:35398524-35398546 AGAAGCAGTGCTTAAAGTCCAGG - Intergenic
1024843678 7:53617660-53617682 AGAAGCAAGTATTAAGCTTCAGG + Intergenic
1027784291 7:82560286-82560308 AAAAGCAGGACTGGAAATTCTGG + Intergenic
1029136676 7:98377724-98377746 AGGAGAATCACTTAAACTTCAGG + Intronic
1029501039 7:100929992-100930014 AGCAGAAGGACTTAAGCCTCAGG - Intergenic
1030865712 7:114699505-114699527 ATATTCAGGAATTAAACTTCAGG + Intergenic
1031648817 7:124260311-124260333 GGAAACAGGATATAAACTTCAGG + Intergenic
1031893261 7:127319988-127320010 AGAAGCAGGATCTAGACCTCAGG + Intergenic
1032184107 7:129708795-129708817 GGAAGCAGAAATTAAACTTAGGG + Intronic
1033161357 7:139000013-139000035 CTAAGCTGGTCTTAAACTTCTGG + Intergenic
1034246322 7:149647237-149647259 AGAAGCAGGACTCAAAGAACTGG + Intergenic
1035666421 8:1383769-1383791 AGAAGCATGAATTAAACTCCTGG + Intergenic
1036400090 8:8400326-8400348 AGAAGCTGGCCTTGAACTCCTGG + Intergenic
1036700633 8:11011555-11011577 AGAAACAGGACAAAAACCTCTGG + Intronic
1037600377 8:20388912-20388934 GGAGGCAGGACTCAAACTTGGGG - Intergenic
1038746033 8:30255821-30255843 CTAGGCTGGACTTAAACTTCTGG - Intergenic
1040017786 8:42713910-42713932 AGAAGCAGGGCTTAGTGTTCAGG - Intronic
1043023489 8:75036387-75036409 AAAAGTAGGACTTAACCTTGCGG + Intergenic
1046593240 8:116230360-116230382 AGAAGCAAGTCTTAATCATCTGG + Intergenic
1046738522 8:117803906-117803928 AGAATCAGGATTTAAAATACAGG - Intronic
1048173195 8:132128204-132128226 AGAACCAGGACTCAAAAGTCAGG - Exonic
1048512298 8:135073722-135073744 AGAAGCTGGCCTGCAACTTCCGG + Intergenic
1049411544 8:142475878-142475900 AGAAGCAGGACCTAAACTCGGGG + Intronic
1049914446 9:303571-303593 ATAAGCAGGAGCTAAACATCGGG + Intronic
1050145833 9:2566511-2566533 AGAAGCAGGACCCAAACTCAGGG + Intergenic
1050386596 9:5097375-5097397 AGAATAAGGATATAAACTTCAGG - Intronic
1050530068 9:6580956-6580978 AGAAGCTGGAAGTAAGCTTCAGG - Intronic
1051597115 9:18835717-18835739 AGAAGCAGGAACTAAACATTGGG - Intronic
1052847561 9:33350779-33350801 CTAAGCTGGACTTGAACTTCTGG - Intronic
1052879475 9:33592312-33592334 AGAAGCAGAACTTAAAAGTTTGG + Intergenic
1052921009 9:33969335-33969357 GGAAGCTGGTCTTAAACTCCTGG - Intronic
1053148934 9:35730815-35730837 AGAAGCAGGGCTAAACTTTCAGG + Intronic
1053151102 9:35743679-35743701 AGAGGCAGGACACATACTTCTGG + Intronic
1053496503 9:38551921-38551943 AGAAGCAGAACTTAAAAGTTTGG - Intronic
1055503193 9:76922252-76922274 CAAAGCAGGACTTAGAATTCTGG + Intergenic
1056408064 9:86295691-86295713 ATAAGCAGGCCTTAAAATTCTGG + Intronic
1057234092 9:93345361-93345383 CCAAGCAGGTCTTAAACTCCTGG + Intronic
1057434746 9:95029451-95029473 AGAAACAGCACTTACACTTGAGG - Intronic
1058018377 9:100062861-100062883 CTAGGCAGGTCTTAAACTTCTGG - Intronic
1058649881 9:107165459-107165481 CCAAGCTGGTCTTAAACTTCTGG + Intergenic
1059048501 9:110896713-110896735 TGAAGCATGACTTAAAATTTGGG + Intronic
1059231445 9:112725135-112725157 AGACTCTGGACTTAAACTTTTGG - Intergenic
1059472177 9:114513947-114513969 AGAACCAGGATTTAAACCCCCGG - Intergenic
1060039208 9:120285227-120285249 CCAAGCAGGAGATAAACTTCAGG + Intergenic
1060070932 9:120546844-120546866 ACAGGCTGGTCTTAAACTTCTGG + Intronic
1061672014 9:132194159-132194181 AGAAGCAGCACTGGGACTTCAGG + Intronic
1062326476 9:136014898-136014920 AGCAGCAGGACTGAACCCTCTGG + Intronic
1062706940 9:137950913-137950935 AAAAACAGGACTTCCACTTCTGG - Intronic
1187030663 X:15484943-15484965 AGAAGCAGAACTTAAAGATTTGG + Intronic
1187479643 X:19643444-19643466 AGAAGCTGGTCTCAAACTCCTGG + Intronic
1187830036 X:23371658-23371680 AGAGGCAGGATTTGAACTTGTGG + Intronic
1188292925 X:28410808-28410830 AGAACCAAGACTTTAACTTAAGG - Intergenic
1189254187 X:39624514-39624536 AGAAGCAGAACTTAAAGATTTGG - Intergenic
1190451474 X:50585541-50585563 AGAATCAGGACTTCATCCTCTGG + Intergenic
1191859178 X:65652039-65652061 AGAGGCTGGTCTTGAACTTCTGG - Intronic
1192301988 X:69914781-69914803 AGAATCAGGACTTACCCATCTGG - Intronic
1192521427 X:71804673-71804695 AGAACCAGGACCTAAACTCAGGG - Intergenic
1194369312 X:93051308-93051330 AGAAGGAGGAAGTAAACTTGTGG + Intergenic
1196523386 X:116701104-116701126 CTAGGCTGGACTTAAACTTCTGG + Intergenic
1199103223 X:143831180-143831202 TGAAGGAGGAGTTAAACTCCTGG + Intergenic
1199685653 X:150263039-150263061 GGAGGCAGGACATAAACTGCTGG - Intergenic
1200677504 Y:6167533-6167555 AGAAGGAGGAAGTAAACTTGTGG + Intergenic
1201963041 Y:19703369-19703391 AGAAGCAGAACTTAAAGATTTGG + Intergenic