ID: 1021521183

View in Genome Browser
Species Human (GRCh38)
Location 7:21540658-21540680
Sequence CTCAGAGGCAAGTCCAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021521183_1021521184 -10 Left 1021521183 7:21540658-21540680 CCTTCGCTGGACTTGCCTCTGAG No data
Right 1021521184 7:21540671-21540693 TGCCTCTGAGCTACAAAAGTCGG No data
1021521183_1021521187 -3 Left 1021521183 7:21540658-21540680 CCTTCGCTGGACTTGCCTCTGAG No data
Right 1021521187 7:21540678-21540700 GAGCTACAAAAGTCGGGTCCAGG No data
1021521183_1021521193 28 Left 1021521183 7:21540658-21540680 CCTTCGCTGGACTTGCCTCTGAG No data
Right 1021521193 7:21540709-21540731 CTGCATTAGCAAGCTAACTAGGG No data
1021521183_1021521192 27 Left 1021521183 7:21540658-21540680 CCTTCGCTGGACTTGCCTCTGAG No data
Right 1021521192 7:21540708-21540730 CCTGCATTAGCAAGCTAACTAGG No data
1021521183_1021521185 -9 Left 1021521183 7:21540658-21540680 CCTTCGCTGGACTTGCCTCTGAG No data
Right 1021521185 7:21540672-21540694 GCCTCTGAGCTACAAAAGTCGGG No data
1021521183_1021521188 1 Left 1021521183 7:21540658-21540680 CCTTCGCTGGACTTGCCTCTGAG No data
Right 1021521188 7:21540682-21540704 TACAAAAGTCGGGTCCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021521183 Original CRISPR CTCAGAGGCAAGTCCAGCGA AGG (reversed) Intergenic
No off target data available for this crispr