ID: 1021523662

View in Genome Browser
Species Human (GRCh38)
Location 7:21562302-21562324
Sequence ATCATAAATGTCTCCAGACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021523657_1021523662 10 Left 1021523657 7:21562269-21562291 CCTTTACCTGCTGGCTCCATCCC 0: 1
1: 0
2: 2
3: 29
4: 342
Right 1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG No data
1021523660_1021523662 -10 Left 1021523660 7:21562289-21562311 CCCTGTTGTGATGATCATAAATG 0: 1
1: 0
2: 3
3: 39
4: 323
Right 1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG No data
1021523658_1021523662 4 Left 1021523658 7:21562275-21562297 CCTGCTGGCTCCATCCCTGTTGT 0: 1
1: 0
2: 4
3: 28
4: 238
Right 1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG No data
1021523659_1021523662 -6 Left 1021523659 7:21562285-21562307 CCATCCCTGTTGTGATGATCATA 0: 1
1: 0
2: 3
3: 17
4: 179
Right 1021523662 7:21562302-21562324 ATCATAAATGTCTCCAGACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021523662 Original CRISPR ATCATAAATGTCTCCAGACA TGG Intronic
No off target data available for this crispr