ID: 1021526260

View in Genome Browser
Species Human (GRCh38)
Location 7:21592392-21592414
Sequence ACTTTGAGGCAGGAGCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 351
Summary {0: 1, 1: 0, 2: 4, 3: 29, 4: 317}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021526260 Original CRISPR ACTTTGAGGCAGGAGCAGCC TGG Intronic
900013646 1:135335-135357 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900014410 1:138301-138323 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900043716 1:491318-491340 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900044275 1:493503-493525 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900065154 1:726321-726343 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900065683 1:728409-728431 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
900555637 1:3279021-3279043 CCTTTGGGGCAGGGGCAGCTGGG + Intronic
901183676 1:7358568-7358590 TCTGTGATGAAGGAGCAGCCGGG - Intronic
901606979 1:10466741-10466763 ACTTGAACTCAGGAGCAGCCTGG + Intronic
902697422 1:18149692-18149714 CCTTCGGGGCAGGATCAGCCTGG + Intronic
902950335 1:19877671-19877693 AAGCTGAGGCGGGAGCAGCCTGG + Intergenic
903045746 1:20563097-20563119 TCCTTGAGGCAGGAACAGCGGGG - Intergenic
903741426 1:25560709-25560731 CTTTTGAGCCATGAGCAGCCTGG + Intronic
903810712 1:26033612-26033634 AAATGGAGGCAGGGGCAGCCTGG - Intronic
905922291 1:41727686-41727708 ACTTTGGGCCAGAGGCAGCCCGG + Intronic
906363690 1:45186696-45186718 ACTTGGTGGCAGAAGCACCCGGG - Intronic
908784309 1:67720025-67720047 ACTTGTAGGAAGGAGCAGCAAGG - Intronic
909551331 1:76900201-76900223 ATTTTGAGCCAGGATGAGCCAGG + Intronic
910121476 1:83795078-83795100 ACTTTGAGCCCAGAGCAGCCTGG + Intergenic
911147462 1:94566690-94566712 CTTTTGAGGCAGGATGAGCCAGG + Intergenic
911725052 1:101234308-101234330 ACTTCTAGGCAGCAGCAGACAGG + Intergenic
912072553 1:105830362-105830384 AACTGGAGGGAGGAGCAGCCAGG - Intergenic
912380857 1:109247524-109247546 ACCTTGAGGCAGGGGTTGCCAGG - Intergenic
912454558 1:109788931-109788953 CCCTGGAGGCACGAGCAGCCTGG - Intergenic
912939454 1:114032236-114032258 CTTTTGAGCCAGGATCAGCCAGG - Intergenic
913314510 1:117538743-117538765 GGTTTGAGGAAGGAGAAGCCAGG + Intergenic
915290476 1:154879822-154879844 GCCTTGAGGCAGAAGCACCCTGG + Intergenic
916865170 1:168848708-168848730 GCTTAGAGGCAGGAACAACCAGG - Intergenic
917410692 1:174757172-174757194 AGGTATAGGCAGGAGCAGCCAGG - Intronic
917794455 1:178522398-178522420 ACTTTGGGGCAGGCACAGCGTGG - Exonic
920764455 1:208818358-208818380 ACCATGAGGCAGGAGGAGCATGG - Intergenic
922100059 1:222472330-222472352 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100264 1:222473158-222473180 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100465 1:222473958-222473980 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922100733 1:222475356-222475378 ATTGTGAGGCAGCAGCTGCCTGG + Intergenic
922262083 1:223951796-223951818 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
922375294 1:224957914-224957936 TATTTGAGGCAGGAGCTGCTTGG + Intronic
922733891 1:227969319-227969341 ATTGTGAGGCAGCAGCTGCCTGG - Intergenic
922734185 1:227970782-227970804 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
922734981 1:227973918-227973940 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
923082543 1:230672373-230672395 ACTGTGTGGCTGGAGCATCCAGG - Intronic
923149069 1:231217798-231217820 CCTTTGAGGGAGCAGCATCCAGG + Intronic
923726112 1:236506864-236506886 AATTAAAGGCAGGAGCAGGCCGG + Intergenic
923956737 1:239031025-239031047 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
924343257 1:243053995-243054017 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
924343728 1:243055875-243055897 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1063189554 10:3680515-3680537 ATATTGTGTCAGGAGCAGCCAGG - Intergenic
1063892460 10:10644603-10644625 TGTCTGAGGCAGGATCAGCCTGG + Intergenic
1064801763 10:19083168-19083190 ACTTTCAGACAAAAGCAGCCTGG + Intronic
1066300200 10:34089558-34089580 ACCATGAGGCTGGAGCAGCCAGG + Intergenic
1066733235 10:38451597-38451619 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1068007431 10:51407912-51407934 ACTTAAAGGTAGGAGGAGCCTGG + Intronic
1068117361 10:52749769-52749791 ACTTTGAGGATGAAGAAGCCTGG - Intergenic
1071747827 10:88441948-88441970 TCTTTGAGGCAGAGGCAGCCGGG + Intronic
1071921222 10:90352704-90352726 ACTTTGAGGCATCACCTGCCTGG - Intergenic
1073293983 10:102427517-102427539 GATTTGTGGCAGGAACAGCCGGG - Intronic
1075651736 10:124131872-124131894 ACTCTGAGGCTGGAGGAGCAGGG + Intergenic
1076346937 10:129785651-129785673 ACCTTGAGGCAGGGGCAGCCAGG + Intergenic
1076583387 10:131530017-131530039 TCTTGGAGGCAGGAGCAGAGTGG - Intergenic
1076875334 10:133213086-133213108 CCATTGAGGCAGCAGCCGCCTGG - Intronic
1076969990 11:127549-127571 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1076970607 11:129978-130000 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1077372621 11:2190474-2190496 CCTGTGGGGCGGGAGCAGCCTGG - Intergenic
1078186190 11:9053822-9053844 CCCTTGAGGAAGGAGCAGCAGGG + Intronic
1078425882 11:11250989-11251011 GCTTTGGGGCAGGAGCCACCTGG - Intergenic
1078908770 11:15711737-15711759 ATTTAGAGGCAGGAGGAGCAAGG - Intergenic
1080740998 11:35064231-35064253 ACTCTGAGGCAGCAGCAGCCTGG + Intergenic
1081190358 11:40096813-40096835 ATTTTGAAACAGGAACAGCCGGG - Intergenic
1084170049 11:67396703-67396725 GCTGGGAGGCAGGAGCTGCCTGG + Intronic
1084320080 11:68368424-68368446 GCTTTGAGGCAGGAGCATGCTGG + Intronic
1084355013 11:68632551-68632573 ATTTTGAGTCAGGATGAGCCAGG - Intergenic
1085531992 11:77197385-77197407 CCTTCTAGCCAGGAGCAGCCTGG - Intronic
1088800672 11:113303990-113304012 AATTTGAGGAAGGAAAAGCCAGG + Intergenic
1088974031 11:114798890-114798912 CCTTTGAGGGAGGGGCAGCCAGG - Intergenic
1089472433 11:118731669-118731691 ATTTTGAGCCAGGAAGAGCCAGG + Intergenic
1090261763 11:125326369-125326391 GCTGTGAGGCAGTGGCAGCCTGG + Intronic
1090925290 11:131244307-131244329 TCTTTGAGACAGGAGTAACCTGG + Intergenic
1092143798 12:6201076-6201098 ACTTTTACGCAGGAGCGGCAGGG + Intronic
1092474927 12:8810334-8810356 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1092579398 12:9821632-9821654 ACTTGGAGGCAGCAGCAGAAGGG - Intergenic
1092924337 12:13259843-13259865 CTTTTGAGGCAGGATGAGCCAGG + Intergenic
1093927494 12:24923506-24923528 AGGTTGAGGCAGGAGAATCCTGG - Intronic
1096046749 12:48569121-48569143 GCTTTGGTGCAAGAGCAGCCAGG - Exonic
1096525187 12:52206349-52206371 TCTTTGAGGCTGGGGCAGGCAGG + Intergenic
1097179027 12:57160388-57160410 GCCCTGAGGCAGGAGGAGCCGGG - Intronic
1099836407 12:87912714-87912736 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
1100940860 12:99721491-99721513 CTTTTGAGGCAGGATGAGCCAGG - Intronic
1103669351 12:122599451-122599473 AGGTTGAGGCAGGAGAACCCAGG - Intronic
1104332006 12:127855746-127855768 ACTCCCAGGCAGGTGCAGCCAGG + Intergenic
1105354353 13:19645181-19645203 TCTCTCAGGCAGCAGCAGCCTGG + Intronic
1105846638 13:24299495-24299517 CCTTGGAGGCAGGGACAGCCCGG + Intronic
1105997035 13:25682383-25682405 CCTAAGAGGCTGGAGCAGCCTGG + Intronic
1107250971 13:38362500-38362522 AGGCTGAGGCAGGAGAAGCCTGG - Intronic
1110128565 13:71978804-71978826 ACTTGCAGCCAGGACCAGCCTGG + Intergenic
1111521158 13:89406301-89406323 TCTTTGAGCCAGGATGAGCCAGG + Intergenic
1111919257 13:94393582-94393604 GCCTTGAGGCAGTAGCAGTCAGG + Intronic
1112392916 13:99001735-99001757 GCCATGAGGCAGGAGCAGGCTGG + Intronic
1112530270 13:100194831-100194853 ACTGTGAGGCATGAGCAGGAAGG + Intronic
1112802981 13:103132851-103132873 AAAATGAGGCAGGTGCAGCCAGG - Intergenic
1113698267 13:112364339-112364361 AGGTGGAGGCAGGAGGAGCCTGG + Intergenic
1114694744 14:24616155-24616177 ACTGTGAGGAGGGAGTAGCCAGG + Intergenic
1115001201 14:28421397-28421419 GTTTTCAGACAGGAGCAGCCTGG - Intergenic
1115965313 14:38880732-38880754 ACCTTGAGGAAGAAGCACCCAGG - Intergenic
1118848979 14:69570589-69570611 AGATTTAGGCAGGAACAGCCTGG + Exonic
1202859690 14_GL000225v1_random:73311-73333 GCATTGCGGCAGGAGCAGCCAGG + Intergenic
1128665237 15:69532708-69532730 GCTATTAGGCAGGAGAAGCCAGG - Intergenic
1128693041 15:69739789-69739811 GCTCTGAGGCAGGAGGAGCCTGG + Intergenic
1129690311 15:77709620-77709642 ACTTTCAGTCTGGAACAGCCGGG - Intronic
1129694028 15:77730537-77730559 ACAGAGAGGCAGGGGCAGCCCGG - Intronic
1131748797 15:95482498-95482520 AGTTTGAGATAGCAGCAGCCTGG + Intergenic
1131998323 15:98154905-98154927 ACCTTGAAGCAGGAGCACCCAGG + Intergenic
1133342477 16:5045590-5045612 ACTGAGAGGCATGAGCTGCCAGG - Intronic
1133403298 16:5504298-5504320 ACTTTGAGGCAGGGCCTGCCAGG + Intergenic
1135103576 16:19627645-19627667 ACTTTGATTGAGGAGAAGCCAGG + Intronic
1136252857 16:29017815-29017837 AGGCTGAGGCAGGAGCATCCTGG + Intergenic
1137457965 16:48632642-48632664 ACTTTTAGGCAGAAGCAGACAGG - Intergenic
1137578391 16:49618963-49618985 ACTTTGAGGCAGGAGGTGGGTGG - Intronic
1137699526 16:50486810-50486832 AAGTTAAGGCAGCAGCAGCCAGG - Intergenic
1138868882 16:60856556-60856578 ACTTGAAAGCAGGAGAAGCCAGG + Intergenic
1139018629 16:62720666-62720688 ACGTTGAGTCAGGAGAAGACAGG + Intergenic
1139833872 16:69822693-69822715 GCTTTGAGGCAGGAACAAGCTGG + Intronic
1142005105 16:87685940-87685962 ACTTTGAGACAAGATCAGCCTGG + Intronic
1142200882 16:88760644-88760666 TCTTCGAGGCAGCAGCACCCAGG + Intronic
1142200897 16:88760705-88760727 CCTTTGACGCAGCAGCACCCAGG + Intronic
1142280097 16:89143490-89143512 TCCGTGGGGCAGGAGCAGCCTGG + Intronic
1142449641 16:90167504-90167526 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1142450689 16:90171583-90171605 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1142456876 17:62108-62130 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1144239372 17:13295181-13295203 ACTGTAAGGCAGGAGCATTCTGG - Intergenic
1145901687 17:28494138-28494160 ACTTGAAGGCAGGGGCTGCCCGG - Intronic
1146184396 17:30715566-30715588 AATTTGAGGGAGGAGCACGCAGG - Intergenic
1148083597 17:44980839-44980861 ACTGGGAGGCAAGGGCAGCCAGG - Intergenic
1148100683 17:45088926-45088948 ACTTTGAGGAAGGAGGAACAAGG + Intronic
1148131976 17:45267519-45267541 ACTTTGAGCAAGGAGGAGTCTGG - Exonic
1149784757 17:59425477-59425499 TCTTCGAGGCAGGAGCATTCTGG + Intergenic
1150759835 17:67951758-67951780 ACTTTGAGAAAGGAGGAGCCAGG + Intronic
1151444418 17:74153854-74153876 ACATTGAGGGAGGAGCTTCCAGG - Intergenic
1152252391 17:79218822-79218844 ACATGGAGGCCGGAGCACCCGGG + Intronic
1152926825 17:83091161-83091183 ACCTTGAGGCCGGTCCAGCCTGG - Intronic
1153571110 18:6474734-6474756 AGATTGAGGCTGCAGCAGCCTGG - Intergenic
1153906197 18:9663474-9663496 ACACAGAGGCAGGGGCAGCCCGG - Intergenic
1155212492 18:23614161-23614183 AGTTTGAGGCAGGAGAACCTGGG - Intronic
1156237062 18:35216171-35216193 ATTTTGAGCCAGGATGAGCCAGG - Intergenic
1156923576 18:42552665-42552687 ATTTTGAGCCAGGATAAGCCAGG + Intergenic
1157566214 18:48680760-48680782 CCTTTGTGGAAGGAGCCGCCGGG + Intronic
1157984141 18:52418410-52418432 TTTTTGAGGCTGGAGCAGGCAGG + Intronic
1158002002 18:52630022-52630044 AGGTTGAGGCAGGAGAACCCAGG + Intronic
1159439624 18:68460616-68460638 ACTGTGAGGCAGAAGCTACCTGG + Intergenic
1159566668 18:70058723-70058745 ATCTTCAGGCAGGAGCATCCAGG + Intronic
1159675850 18:71283560-71283582 ATTTTGAGCCAGGATGAGCCAGG + Intergenic
1160021482 18:75185149-75185171 AGTTTGAGGCACCAGCAGGCAGG - Intergenic
1160646788 19:197467-197489 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1161384408 19:3983367-3983389 TCATGGAGGGAGGAGCAGCCTGG - Intronic
1163362906 19:16859246-16859268 GCTTTGGGGCTGGAGCACCCTGG - Intronic
1165776773 19:38409177-38409199 ACTTTGAGGGTCGAGCAGCAGGG - Exonic
1166546094 19:43635631-43635653 AGTTTGAGGGAGGAGGAGGCTGG - Intronic
1167868037 19:52344184-52344206 TCTCTGAGGCAGGAGAAACCTGG - Intronic
1168102192 19:54147253-54147275 AATGTTAGGCAGGAGCAGCATGG + Intronic
925002796 2:419637-419659 ACTTGGAGGAAAGAGAAGCCTGG - Intergenic
925179388 2:1807117-1807139 CCTGGGAGACAGGAGCAGCCTGG + Intronic
926662397 2:15481937-15481959 ACTGTGAGGCAGGAGCCCTCTGG - Intronic
927148123 2:20180171-20180193 GCTCTGTGGCAGGAGCAGCTTGG - Intergenic
927892337 2:26759515-26759537 AGGGTGAGGCAGGAGAAGCCTGG + Intergenic
928777976 2:34789984-34790006 CTTTTGAGGCAGGATGAGCCAGG - Intergenic
929424746 2:41832588-41832610 ACCTAGAGGCAAGAGGAGCCAGG - Intergenic
929899740 2:45990437-45990459 ACTATGAGGCAGGGGCAATCAGG + Intronic
930087282 2:47506757-47506779 ACATGGGTGCAGGAGCAGCCAGG + Intronic
931144523 2:59502565-59502587 ACTCAGAGTCAGGAGCAGACTGG + Intergenic
931775089 2:65533318-65533340 TCTGTGAGGTGGGAGCAGCCAGG + Intergenic
932417356 2:71581505-71581527 AAGCTGAGGCTGGAGCAGCCAGG + Intronic
935173129 2:100626180-100626202 ACTTTGAGGACGGAGCCCCCAGG + Intergenic
937279162 2:120705544-120705566 ACTTTAAGAAAGAAGCAGCCGGG - Intergenic
938087555 2:128411461-128411483 ACTGTGAGCCAGGCGCAGCGTGG + Intergenic
939911240 2:147985710-147985732 ACTTTGTGGGAGAAGCAACCTGG + Intronic
939914149 2:148020133-148020155 GCTTTGGGGAAGGAGCAGGCAGG - Intronic
942045026 2:172095154-172095176 ACTTCGGGGCAGGAGAAGCGAGG - Intergenic
943412121 2:187558165-187558187 GCTTTGAGCCAGGATGAGCCAGG + Intronic
947430369 2:230022562-230022584 ACTTGAAGTCAGGAGCAGCTGGG - Intergenic
947445262 2:230158108-230158130 GCCTTGAGGCAGGAGTGGCCTGG + Intergenic
948126059 2:235565273-235565295 GGTATGAGCCAGGAGCAGCCTGG + Intronic
948264077 2:236624855-236624877 GCTTTCAGGCTGGAGCAGTCAGG + Intergenic
948417226 2:237818794-237818816 ATTTTGTGGGAGGAGCTGCCAGG - Intronic
1170105750 20:12753149-12753171 ATTTTGAGCCAGGATGAGCCAGG - Intergenic
1171470316 20:25365007-25365029 ACATGGAGGCAGGTGTAGCCAGG + Intronic
1172625384 20:36343701-36343723 AATTTGGGACAGGAGCAGCTTGG + Intronic
1172650258 20:36497476-36497498 GCTTGGCGGCAGGAGCAGCATGG + Intronic
1172753458 20:37267492-37267514 ACTTGGAGGCAGAGGCAGGCAGG + Intergenic
1173622170 20:44445106-44445128 CCTTTGAGGGAGGAAGAGCCAGG - Intergenic
1173722252 20:45269644-45269666 CCTTTGAGGGAGTAGCTGCCTGG - Intergenic
1174049726 20:47759215-47759237 CCTGTGAGCCATGAGCAGCCAGG - Intronic
1175874159 20:62221547-62221569 ACTTTGGGGAAGGAGGAGCTGGG + Intergenic
1175929122 20:62485290-62485312 ACTTGGAGGCAGGCGCAGCCTGG - Intergenic
1176278714 20:64288759-64288781 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1177102367 21:16914292-16914314 ATTTTGAGCCAGGATGAGCCAGG - Intergenic
1178981812 21:37270646-37270668 ACCTTGAGCCAGGAACACCCAGG - Intergenic
1181536459 22:23548803-23548825 ACTTTGGGGCAGGATCACCTGGG + Intergenic
1182800780 22:33030141-33030163 AGTTGGAGGCAGCAGCAGGCAGG + Intronic
1183097368 22:35561171-35561193 ACTTTGAGGAAAGAGAAGGCAGG - Intergenic
1183247931 22:36708294-36708316 ACTGTGAGGCAGGAGCAGGTTGG + Intergenic
1183343864 22:37296260-37296282 GCCTTGGGGCAGGAGGAGCCAGG + Intronic
1184492844 22:44820239-44820261 ACTCTGGGACAGGTGCAGCCAGG - Intronic
1184921017 22:47605957-47605979 CCACTGAGGGAGGAGCAGCCAGG + Intergenic
949283687 3:2376437-2376459 CCTTTTGGGCAGGAGCAGTCAGG + Intronic
949732571 3:7130879-7130901 ATTTTCAGGCTGGAGTAGCCTGG - Intronic
950740333 3:15045845-15045867 TCATTGAGGGAGGAGCAGCCAGG - Exonic
951464140 3:22983848-22983870 AATTTGAGGCAGGAAAAGTCTGG + Intergenic
951707534 3:25558382-25558404 AATTTGAAGCAGCAGCAGCCTGG - Intronic
954091715 3:48289583-48289605 GCTGTAAGGGAGGAGCAGCCAGG - Intronic
955072165 3:55581041-55581063 GCCTTGAGGCAGGAGGTGCCTGG + Intronic
956460166 3:69463661-69463683 ACTTGGAGGCAGATGCAGTCTGG - Intronic
960585127 3:119314139-119314161 ACTTGGAGGCAAGAGCGGCATGG - Intronic
961345251 3:126259967-126259989 ACTGTGGGGCAGGAGGTGCCAGG + Intergenic
961434780 3:126909350-126909372 GCTTTGGGGCAGGGGCTGCCGGG + Intronic
961492231 3:127263926-127263948 GCTTTGTGGCAGCAGCAGCAGGG + Intergenic
961690375 3:128665115-128665137 AGTCTGAGGCAGGAGAAGGCAGG + Intronic
962233664 3:133689229-133689251 AGTCTGAGGCAGGAGAACCCAGG + Intergenic
963156886 3:142108838-142108860 CCCTTGAGGCAGGAGGAGCACGG - Intronic
963833129 3:150030127-150030149 TCTTTGAGGAAGGAGCAGCTGGG + Intronic
965624386 3:170672401-170672423 ATTTTGAGCCAGGATGAGCCAGG + Intronic
966066019 3:175822939-175822961 CTTTTGAGGCAGGATAAGCCAGG - Intergenic
968370893 3:198222055-198222077 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
968457694 4:707313-707335 ACTTTAAGGCAGGACCTTCCTGG - Intronic
968624202 4:1619213-1619235 AGGCTGAGGCAGGAGCTGCCAGG + Intronic
968673417 4:1864314-1864336 CCTTGGAGGCAGGAGCCACCTGG + Intergenic
968956632 4:3722799-3722821 GCTTTGGGGGATGAGCAGCCTGG - Intergenic
969330505 4:6471534-6471556 ATATTGAGACAGGAGCAGCTGGG - Intronic
974935719 4:68407417-68407439 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
975527334 4:75364836-75364858 TTTTTGAGGGAGGTGCAGCCAGG - Intergenic
975859182 4:78658144-78658166 ACACTGAGACAGGAGCAGACTGG + Intergenic
976641785 4:87346818-87346840 ACACTGAGGCAAGATCAGCCTGG + Intronic
977205313 4:94159055-94159077 ACTTAGAGGTAGGAGGAGCGTGG - Intergenic
977451705 4:97207130-97207152 GCTTTGAATCAGGAGCTGCCTGG + Intronic
977471745 4:97452020-97452042 AAGTTGAGGCAGGAGCTCCCTGG + Intronic
977817301 4:101429670-101429692 ACTTTGAGGGAGGAGAGGCTGGG + Intronic
979259347 4:118633682-118633704 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
979259575 4:118634543-118634565 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
979328799 4:119406081-119406103 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
979329003 4:119406881-119406903 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
980111459 4:128641117-128641139 CTTTTGAGCCAGGAGGAGCCAGG + Intergenic
980558955 4:134446422-134446444 AATTTTAGGCATGAGAAGCCTGG + Intergenic
982438041 4:155400113-155400135 GCCCTGAGGCAGGAGCAGCTTGG - Intergenic
984436932 4:179720689-179720711 ATTTTGAGCCAGGATGAGCCAGG - Intergenic
984495643 4:180494002-180494024 AGGTTGAGGCAGGAGGAGCCTGG + Intergenic
986243216 5:5980289-5980311 ACTTGGAGGAAGGGGCAGGCAGG - Intergenic
988698570 5:33649306-33649328 ATTTTGGGGCAGGAGCAATCTGG + Intronic
992123628 5:73619493-73619515 TCTTTGAGGGAGGAGTATCCAGG + Intergenic
993759845 5:91780951-91780973 ACCTTGAGGCAGAGGCACCCAGG - Intergenic
994124091 5:96150633-96150655 ACTCTGAGGAAGGAGCAGACTGG + Intergenic
994126417 5:96172196-96172218 CCTTTGAGCCAGGATGAGCCAGG + Intergenic
994776393 5:104039975-104039997 CTTTTGAGGCAGGATGAGCCAGG + Intergenic
997518791 5:134508940-134508962 ACTGGGCAGCAGGAGCAGCCTGG - Intergenic
997679202 5:135737312-135737334 ACTTTGAGCCAGGATGAGCCGGG + Intergenic
998212882 5:140214575-140214597 CCTTTCACCCAGGAGCAGCCTGG + Intronic
998593415 5:143501825-143501847 GCTCTGAGGCAGGAAGAGCCTGG - Intergenic
998741278 5:145204973-145204995 ATTTTCAGCCAGGAGGAGCCTGG + Intergenic
999197804 5:149794644-149794666 CCTTTGAGGCAGGAGAAGGGTGG + Intronic
999258297 5:150222181-150222203 ACTTTGAGGCAGGAGGCTCCTGG + Intronic
999537153 5:152529686-152529708 GCTTGGAGGCAGGAGGTGCCTGG + Intergenic
1000295372 5:159908922-159908944 ACTTTTAGACAGGAGCAGCCTGG - Intergenic
1001230543 5:169983674-169983696 CCCTTGGGGCAGGAACAGCCTGG - Intronic
1001592635 5:172876178-172876200 GCATTCAGGCAGGGGCAGCCTGG + Intronic
1001637640 5:173223493-173223515 ACTCTGAGGCAGGAATTGCCAGG + Intergenic
1001674290 5:173499511-173499533 GCCTGGAGGCAGGGGCAGCCGGG - Intergenic
1002258859 5:177980768-177980790 AGTTTGAGGCAGCAGCAAGCTGG - Intergenic
1002729568 5:181325426-181325448 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1002730127 5:181327611-181327633 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1002754405 6:146488-146510 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1002787229 6:411598-411620 TCTGTGTGGGAGGAGCAGCCCGG - Intergenic
1006177373 6:32130484-32130506 ACTTTGACTCTTGAGCAGCCTGG - Intergenic
1006635219 6:35456976-35456998 ACTAGGAGGCAGGGGCAGACTGG - Intronic
1009343266 6:62586145-62586167 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1010471122 6:76229862-76229884 AATGTGAGGGAGGAGCAACCAGG + Intergenic
1011584374 6:88908854-88908876 ACTGTCTTGCAGGAGCAGCCAGG - Intronic
1012942895 6:105434987-105435009 ACTTTGAGGCAGTGGCAGTCTGG + Intergenic
1015375760 6:132508534-132508556 TGTTTGAGACAGGAGCACCCAGG + Intronic
1016204187 6:141452989-141453011 CCTTTGAGCCAGGATGAGCCAGG - Intergenic
1017327404 6:153155093-153155115 TTTTTGAGGCAGGGGCAGCGGGG + Intergenic
1017792649 6:157814999-157815021 AGTTTGAGGCAGGAGCAGTGCGG + Intronic
1017825313 6:158077340-158077362 GCTGTGATGCAGGGGCAGCCAGG - Intronic
1019136956 6:169915220-169915242 ACTGTGTGCCAGGACCAGCCTGG + Intergenic
1019453802 7:1114205-1114227 ACTTTGAGTAAGGAACAGCCCGG - Intronic
1019500556 7:1362425-1362447 ACCCTGGGGCAGGACCAGCCTGG - Intergenic
1019601309 7:1885154-1885176 TCTCTGAGGCTGGAGCAGCGAGG - Intronic
1019897454 7:3993762-3993784 CCTTTGAGGCAGAAGAAGCCAGG - Intronic
1020446901 7:8278258-8278280 ACTGAGAGGCTGGAGCAGCCTGG + Intergenic
1021123290 7:16821217-16821239 ACTTTGAGGGAGTAGCAGGGTGG + Intronic
1021526260 7:21592392-21592414 ACTTTGAGGCAGGAGCAGCCTGG + Intronic
1023400792 7:39792213-39792235 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024073966 7:45809265-45809287 ATTGTGAGGCAGCAGCTGCCTGG - Intergenic
1024075286 7:45814811-45814833 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1024350696 7:48359697-48359719 ACTTTGAGGCAAGTGCAGGGAGG - Intronic
1024648313 7:51386512-51386534 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1024648844 7:51388585-51388607 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1024649366 7:51390933-51390955 ATTGTGAGGCAGCAGCTGCCTGG + Intergenic
1025052163 7:55740981-55741003 ACTGGGAGGCAGGAGAAGCTGGG + Intergenic
1025053155 7:55744800-55744822 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic
1025053445 7:55746262-55746284 ATTGTGAGGCAGCAGCTGCCTGG + Intergenic
1025182349 7:56829802-56829824 ATTGTGAGGCAGCAGCTGCCTGG + Intergenic
1025689578 7:63747192-63747214 ATTGTGAGGCAGCAGCTGCCTGG - Intergenic
1027517162 7:79156595-79156617 AATTTGAAGCAGGAGCTTCCAGG - Intronic
1029060764 7:97795867-97795889 AATATGAGGAAGGAGGAGCCAGG - Intergenic
1030442004 7:109597404-109597426 ATTTTGAGCCAGGATGAGCCAGG + Intergenic
1032051289 7:128652547-128652569 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1033794497 7:144831582-144831604 AGCCTGAGGCAGGAGAAGCCAGG + Intronic
1034275830 7:149823462-149823484 ACCTTGGGGCAGTAGCAGCCCGG - Intergenic
1034850156 7:154486069-154486091 ACACTGAGGCAGGAACACCCTGG - Intronic
1036486524 8:9184310-9184332 CCTTTGAGCCAGGATGAGCCGGG + Intergenic
1037365073 8:18113591-18113613 AGGTTGAGGCAGGAGAACCCGGG - Intergenic
1037676589 8:21056435-21056457 ATTCTGAGGCATGAGCTGCCAGG - Intergenic
1038714740 8:29981428-29981450 ACTCTCAGGAAGCAGCAGCCCGG + Intergenic
1038896762 8:31792005-31792027 ACTTCAAGCCAGCAGCAGCCAGG + Intronic
1040292150 8:46131032-46131054 ACTTTGAGGCAGGCAGAGCAGGG - Intergenic
1040361885 8:46673590-46673612 AGGCTGAGGCAGGACCAGCCTGG - Intergenic
1040674544 8:49733303-49733325 ACTTTGAAGCAAGAGCAGCTGGG + Intergenic
1041478554 8:58292836-58292858 TCTTAGAGGCGGGAGCAGCATGG + Intergenic
1047175964 8:122540567-122540589 ACTTAGAGGCAGGAGATTCCTGG - Intergenic
1048279959 8:133098430-133098452 ACTCTGAGGCATGGGCAGACTGG + Intronic
1048728735 8:137413703-137413725 ATTTTGAGCCAGGATGAGCCAGG + Intergenic
1049031672 8:140042738-140042760 AAATTGACTCAGGAGCAGCCCGG - Intronic
1049209401 8:141378623-141378645 ACACTGAGCCAGGGGCAGCCTGG - Intergenic
1049394928 8:142395536-142395558 ACAGTGAGGCTGGAGCTGCCAGG + Intronic
1049434387 8:142579722-142579744 CCTCAGAGGCAGGTGCAGCCCGG - Intergenic
1049674854 8:143884879-143884901 CTGGTGAGGCAGGAGCAGCCAGG - Intergenic
1051227670 9:14918995-14919017 ACTTGGAGGCAGGAGAAACAAGG + Intergenic
1051342917 9:16128202-16128224 CCTTTGAGGCAGGATGAGCAGGG + Intergenic
1055218316 9:73895364-73895386 ACCCTGTGGCATGAGCAGCCAGG + Intergenic
1055287689 9:74746778-74746800 GCTTTAAGGCAGGAGCAGTAGGG + Intronic
1058054815 9:100438842-100438864 CCTTTGAGGAAGAAGGAGCCTGG + Intronic
1058484493 9:105429989-105430011 TCACTGAGGCAGGAGGAGCCTGG - Intronic
1061037960 9:128123914-128123936 ACTCTGAGGCTGGGGCAGCGGGG - Intronic
1062082116 9:134629716-134629738 GCTCAGAGGCAGGAGCAGGCAGG - Intergenic
1062278891 9:135743302-135743324 GCTTTGAGGCCAGGGCAGCCAGG + Intronic
1062519419 9:136951566-136951588 TCTTTTAGGCAGGACCAGCATGG + Intronic
1062754542 9:138280125-138280147 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203787774 EBV:137238-137260 TCCCTGAGGCGGGAGCAGCCGGG + Intergenic
1203577539 Un_KI270745v1:20695-20717 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1203578444 Un_KI270745v1:24285-24307 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1185477125 X:422022-422044 ACTTTGAGGCACCTGCGGCCGGG + Intergenic
1186384301 X:9093596-9093618 ACTTTAAAGCAGGAGCTGCAGGG - Intronic
1186446918 X:9637948-9637970 ATTTTGGGGGAGGAGCAGGCTGG + Intronic
1187386392 X:18852503-18852525 ACTTTCAGGCAGGGGCAGCTTGG - Intergenic
1192958066 X:76094905-76094927 ACTTTGAAGCAGGGGCATTCTGG + Intergenic
1193009166 X:76656912-76656934 ATTAGGAGGCAGAAGCAGCCAGG + Intergenic
1194703294 X:97142447-97142469 ACTCTGAGGCTGGAGCAGTAAGG + Intronic
1195818082 X:108910209-108910231 ACTTTGAGCCAGGATGAGCCAGG - Intergenic
1196921679 X:120591734-120591756 CCTTAGAGGCAGCTGCAGCCTGG - Intergenic
1200216682 X:154371244-154371266 ATTTTGAGGCGCGAGAAGCCGGG + Exonic
1201728831 Y:17184514-17184536 AGTGTGAGTCAGGGGCAGCCTGG + Intergenic
1202075899 Y:21037815-21037837 ATTTTGAGCCAGGATGAGCCAGG - Intergenic
1202381082 Y:24276911-24276933 ACTGGGAGGCAGGAGGAGCTGGG - Intergenic
1202489703 Y:25393215-25393237 ACTGGGAGGCAGGAGGAGCTGGG + Intergenic