ID: 1021526640

View in Genome Browser
Species Human (GRCh38)
Location 7:21595430-21595452
Sequence GATTAGAAGTAGTTGGATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021526638_1021526640 -1 Left 1021526638 7:21595408-21595430 CCAGGGTGGTAGCAGTGAAAGTG 0: 1
1: 5
2: 22
3: 106
4: 466
Right 1021526640 7:21595430-21595452 GATTAGAAGTAGTTGGATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021526640 Original CRISPR GATTAGAAGTAGTTGGATTC TGG Intronic
No off target data available for this crispr