ID: 1021528315

View in Genome Browser
Species Human (GRCh38)
Location 7:21614071-21614093
Sequence ATGCTTTGGAATTGCGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 310
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 299}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021528315 Original CRISPR ATGCTTTGGAATTGCGAGGC TGG (reversed) Intronic
900954837 1:5880383-5880405 ATGTTTTGCAATTGAGAGACAGG + Intronic
903012134 1:20338774-20338796 GTGCTTTGGGAGTTCGAGGCAGG - Intronic
904016196 1:27422890-27422912 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
905411276 1:37770314-37770336 ATGCTTTGGGAGGTCGAGGCAGG - Intergenic
905420899 1:37843245-37843267 TTGCTTTGGGATGCCGAGGCAGG - Intronic
905714333 1:40135137-40135159 GTGCTTTGGAAGTCCAAGGCAGG - Intergenic
906483134 1:46214097-46214119 ATACTTTGGAAGGCCGAGGCTGG + Intronic
909900297 1:81126496-81126518 ATGCTGAGGAATTTGGAGGCAGG + Intergenic
911411170 1:97509290-97509312 TGGCTTTGGCATTGTGAGGCAGG + Intronic
912653211 1:111459916-111459938 ACACTTTGGAAGGGCGAGGCAGG + Intronic
915241121 1:154522557-154522579 ATGCTTTGGGAGACCGAGGCAGG + Intronic
915601804 1:156927305-156927327 ATGGCTTGGAATTTCGAGACAGG - Intronic
916611109 1:166392607-166392629 AAGCTGTGGAATGGGGAGGCTGG + Intergenic
917088049 1:171323415-171323437 ATACTTTGGAAGGCCGAGGCAGG + Intronic
919816087 1:201440532-201440554 GTGCTTTGGGATGCCGAGGCGGG - Intergenic
920011224 1:202869159-202869181 ATACTTTGGGAGTCCGAGGCAGG - Intergenic
922292770 1:224222366-224222388 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
922931688 1:229395080-229395102 GTGCTTTGGGAGTCCGAGGCGGG + Intergenic
922943906 1:229493769-229493791 ATGCTTAGGAATTGCTATGCAGG - Intronic
923061994 1:230484163-230484185 ATACTTTGGAAGGCCGAGGCAGG + Intergenic
923608132 1:235463861-235463883 AAGATTTGAAATTGGGAGGCTGG - Intronic
923669978 1:236031995-236032017 TTGGTTTGGAATTCAGAGGCAGG + Intronic
923669983 1:236032036-236032058 TTGGTTTGGAATTCAGAGGCAGG + Intronic
924118600 1:240773042-240773064 ATGATTTGGAATTACCAGGAAGG + Intergenic
924134078 1:240944955-240944977 ATGCTTGGGAAGGCCGAGGCAGG - Intronic
924928564 1:248706859-248706881 ATGCTTTGGGAAGCCGAGGCAGG + Intergenic
1063361322 10:5461773-5461795 TTTCTTTGAAATTACGAGGCAGG + Intergenic
1064644628 10:17448366-17448388 ATGATTTGGGATTGTGTGGCTGG - Intronic
1065828600 10:29594801-29594823 ATGCTTTGGAAGGCTGAGGCAGG - Intronic
1066146600 10:32564863-32564885 ATGCTTTGGAAGGCTGAGGCAGG + Intronic
1066212709 10:33255696-33255718 GTGCTTTGGGAGGGCGAGGCAGG - Intronic
1066354162 10:34665591-34665613 ACACTTTGGGATGGCGAGGCAGG + Intronic
1068701430 10:60024220-60024242 ATGCTTTGGGAGGCCGAGGCGGG + Intergenic
1068938784 10:62660773-62660795 ATGCCTTGGAATTGCTAGCAAGG - Intronic
1068976115 10:63011487-63011509 ATGCTTTGGGAGTCCAAGGCGGG - Intergenic
1069305696 10:66965901-66965923 AGGCTTTGGAATTGCCAAGGAGG - Intronic
1069980525 10:72249195-72249217 ATGCTTTGGAAATGCGGGATGGG - Intergenic
1071842539 10:89487552-89487574 ACACTTTGGAAGTCCGAGGCTGG + Intronic
1072246586 10:93549063-93549085 GTACTTTGGAAGGGCGAGGCGGG + Intergenic
1073392150 10:103188108-103188130 ATGCTTTGGGAGGCCGAGGCAGG + Intronic
1074469888 10:113717296-113717318 ATACTTTGGGAGGGCGAGGCGGG + Intronic
1074566989 10:114588749-114588771 ATACTTTGGAAGGCCGAGGCTGG - Intronic
1074604881 10:114952190-114952212 ATACTTTGGAAGGCCGAGGCGGG + Intronic
1077063786 11:629277-629299 GTGCTTTGGAAGGCCGAGGCAGG - Intergenic
1078234674 11:9473142-9473164 ACGCTTTGGAAGGCCGAGGCGGG + Intronic
1078469375 11:11574896-11574918 ATGCTTTGGGTCTGAGAGGCTGG - Intronic
1078872693 11:15363677-15363699 AGTCTTTGGAGTTGTGAGGCTGG + Intergenic
1078996427 11:16705376-16705398 ATACTTTGGAAGGTCGAGGCAGG + Intronic
1080048998 11:27839195-27839217 ATGATTTGGAATTGCCACCCTGG - Intergenic
1080277122 11:30515007-30515029 ATCCTTTGAATTTGGGAGGCAGG + Intronic
1081633752 11:44706973-44706995 ATGCTTTGGGAGGCCGAGGCAGG + Intergenic
1082696515 11:56372711-56372733 CTTCATTGGAATTGCAAGGCAGG - Intergenic
1083293376 11:61702145-61702167 ATGCTTTGGGAGGCCGAGGCTGG - Intronic
1083413230 11:62508053-62508075 ATGCTTTGGGAGGCCGAGGCAGG - Intronic
1083948897 11:65942909-65942931 ATGCTTTGGGAGGCCGAGGCAGG + Intergenic
1084111654 11:67018013-67018035 ATGCTTTGGGAGGCCGAGGCAGG + Intronic
1085781612 11:79414406-79414428 ATACTCTGGGATTGGGAGGCAGG - Intronic
1085801249 11:79591691-79591713 ATACTTTGGAAGGCCGAGGCAGG - Intergenic
1085949873 11:81317556-81317578 GCACTTTGGAAGTGCGAGGCAGG + Intergenic
1086832564 11:91583666-91583688 ATGCTTTGGAATTTCCAGTTAGG - Intergenic
1086994532 11:93341169-93341191 ATGCTTTGGAAGGCCAAGGCAGG + Intronic
1088930279 11:114344337-114344359 ATGCTTTGGAAGGGCAAGGTGGG + Intergenic
1089030534 11:115323413-115323435 ATGCTGTGGAATTTCAAGACTGG - Intronic
1089414988 11:118280899-118280921 GCGCTTTGGAAGGGCGAGGCAGG - Intergenic
1091394930 12:148338-148360 ATGCATTGGAATTGCGTGGCGGG - Intronic
1094288786 12:28822467-28822489 ATGCTTTGGAAGGCCAAGGCAGG + Intergenic
1094553269 12:31472536-31472558 ATGCTTTGGAAGGCCGAGGTGGG - Intronic
1096804456 12:54131937-54131959 ATCCCTTGGAATGGAGAGGCTGG + Intergenic
1096935995 12:55277139-55277161 ATGCATTGGCATTTTGAGGCAGG - Intergenic
1097109116 12:56645208-56645230 ATGCCCTGGAAGTGCAAGGCAGG - Exonic
1098153524 12:67573007-67573029 ATACTTTGGAACTGGGAGGGAGG + Intergenic
1098874603 12:75853956-75853978 CTGCTGTGCAATTGCTAGGCAGG - Intergenic
1098887519 12:75975405-75975427 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
1099227158 12:79983250-79983272 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
1100254234 12:92865993-92866015 ATGCTTTGGGAGGCCGAGGCGGG - Intronic
1102099133 12:110264255-110264277 GTGCTTTGGGAAGGCGAGGCGGG + Intergenic
1102111897 12:110371321-110371343 ATTTTTTGGAATTCAGAGGCAGG + Intergenic
1102280697 12:111616573-111616595 ATACTTTGGGAGTTCGAGGCAGG + Intergenic
1102344457 12:112150493-112150515 ATGCTTTGGGAGTCCAAGGCAGG - Intronic
1103387026 12:120541101-120541123 ATGCTTTGGGAGGCCGAGGCGGG - Intronic
1106890869 13:34244075-34244097 ATGCTTTGGGAGGCCGAGGCAGG + Intergenic
1108599287 13:51977049-51977071 ATGCTTTGGGAGGCCGAGGCAGG + Intronic
1108603490 13:52015154-52015176 ATGCTTTGGAAGGCCAAGGCAGG + Intronic
1109524699 13:63560151-63560173 AGGCTTGAGAATAGCGAGGCTGG - Intergenic
1111513667 13:89298643-89298665 ATGCAATGAAGTTGCGAGGCAGG + Intergenic
1112385081 13:98931842-98931864 GTGCTTTGGGAGTGTGAGGCAGG - Intronic
1112580330 13:100672736-100672758 ATGCTTTGGAAGGCTGAGGCAGG - Intronic
1114466352 14:22925571-22925593 ATACTTTGGAAGGCCGAGGCGGG + Intronic
1115649620 14:35393695-35393717 GTGCTTTGGGAGGGCGAGGCAGG - Intergenic
1116601528 14:46930968-46930990 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
1118911630 14:70066562-70066584 GTGCTTTGGAAGGCCGAGGCGGG + Intronic
1118922474 14:70162141-70162163 ATGCTCTGGAAGTGTGAGTCCGG - Intronic
1119099789 14:71869175-71869197 ATACTTTGAAAATGCAAGGCAGG - Intergenic
1119394374 14:74315450-74315472 GTGCTTTGGGATGCCGAGGCGGG + Intronic
1119592578 14:75903655-75903677 ATGCTTTGGAAAGACGAGGCAGG + Intronic
1119809311 14:77503013-77503035 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
1120946161 14:89999325-89999347 TTGCTTTAGAATAGTGAGGCAGG + Intronic
1122230311 14:100303701-100303723 AGGCTTTGGAGTTGGGAGACAGG - Intronic
1122715120 14:103692014-103692036 ATGCTTTGGAAGGCCAAGGCAGG - Intergenic
1123465333 15:20510808-20510830 ATGCTTTGGGATGCCAAGGCAGG + Intergenic
1123652783 15:22490220-22490242 ATGCTTTGGGATGCCAAGGCAGG - Intergenic
1123879091 15:24657842-24657864 ACGCTTTGGAAGTCCAAGGCAGG - Intergenic
1124111978 15:26798933-26798955 GTGCTTTGGAATGCCGAGGCAGG + Intronic
1125278665 15:38021242-38021264 ATGCTTTGGATTTTCTAGGAAGG - Intergenic
1125977797 15:43971001-43971023 ATGCTTTGGGAGGGCGAGGAAGG + Intronic
1126007963 15:44276702-44276724 ATGCTTTGGGAGGCCGAGGCGGG + Intergenic
1127228400 15:56960674-56960696 ATACTTTGGAAAGCCGAGGCAGG - Intronic
1127768474 15:62210803-62210825 AAACTTTGGAATTGGGTGGCAGG + Intergenic
1128009716 15:64281356-64281378 AAACTTTGGAAGGGCGAGGCAGG + Intronic
1129606006 15:77025346-77025368 ATCTTTTGGGACTGCGAGGCTGG + Intronic
1131124199 15:89844593-89844615 ATGCTTTGGAAGGCTGAGGCGGG - Intronic
1131912029 15:97216995-97217017 ATGCTTTGGGAGTCCAAGGCAGG - Intergenic
1131924383 15:97365850-97365872 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
1133623980 16:7552927-7552949 GTGCTTTGGGAGTCCGAGGCGGG - Intronic
1135804763 16:25532929-25532951 GTGCTTTGGGAGTCCGAGGCAGG - Intergenic
1139371928 16:66474348-66474370 ATGCCTTGGAGGTGCCAGGCTGG - Intronic
1139645122 16:68323514-68323536 ATTCTTTAGAATTACCAGGCCGG - Intronic
1142952147 17:3492121-3492143 ATGCTTTGGGAAGCCGAGGCAGG - Intronic
1143540687 17:7566717-7566739 ATGCTCTGGAAGGCCGAGGCAGG + Intronic
1143649095 17:8252045-8252067 ACGCTTTGGGAGTCCGAGGCGGG + Intronic
1144168756 17:12638047-12638069 ATAATTTGGAATTGCCAGGGAGG + Intergenic
1144288374 17:13801498-13801520 ATGCTTTGGGAGGCCGAGGCGGG - Intergenic
1144295491 17:13871271-13871293 ATGCGTTGGAAGGACGAGGCAGG - Intergenic
1144742285 17:17590819-17590841 ATCCATTGGAATTGGGAGCCTGG + Intronic
1145106724 17:20124045-20124067 AAGTTTTGGAGTTGAGAGGCCGG + Intronic
1145819877 17:27824096-27824118 GTGCTTTGGAAGGCCGAGGCGGG - Intronic
1146062942 17:29616590-29616612 GTGCTTTGGAAAAGCGGGGCGGG - Intronic
1146693372 17:34891710-34891732 GTACTTTGGAAGGGCGAGGCAGG + Intergenic
1146718339 17:35104913-35104935 ATGCTTTGGAAGGCCAAGGCAGG - Intronic
1148411924 17:47474883-47474905 ATGCTTTGGGAGGTCGAGGCGGG + Intergenic
1148683558 17:49488151-49488173 ATGCTTTGGGAGGCCGAGGCGGG - Intergenic
1149968436 17:61191527-61191549 GTGCTTTGGGAGTCCGAGGCGGG + Intronic
1151125444 17:71839503-71839525 GTGCTTTGGAAGGCCGAGGCAGG + Intergenic
1152506930 17:80755488-80755510 ATGCTTTGGGAAGGTGAGGCAGG + Intronic
1152513677 17:80808046-80808068 ATGCTTTGGAAAGCTGAGGCAGG + Intronic
1153794587 18:8610102-8610124 AGGCTTTGGGATTGGGATGCAGG - Intronic
1153813998 18:8777338-8777360 ATGCTTTGGGATACCAAGGCGGG - Intronic
1155552043 18:26974919-26974941 ACACTTTGGAAGTCCGAGGCAGG - Intronic
1156277583 18:35598279-35598301 ATACTTTGGAAGGCCGAGGCAGG - Intronic
1156873554 18:41977729-41977751 ATGCTTTGGGAGGCCGAGGCGGG - Intronic
1161117795 19:2508623-2508645 ATGCTTTGGGAGGCCGAGGCTGG - Intergenic
1161184196 19:2905413-2905435 ATACTTTGGAATGCCGAGGGGGG - Intronic
1161350993 19:3791587-3791609 ATACTTTGGGATGCCGAGGCGGG - Intronic
1162481678 19:10930518-10930540 GCACTTTGGAAATGCGAGGCAGG - Intronic
1162871699 19:13591312-13591334 ATGCTTTGGGAGGCCGAGGCAGG + Intronic
1163553393 19:17978806-17978828 ATACTTTGGAAGGCCGAGGCAGG + Intronic
1165409079 19:35647682-35647704 ACGCTTTGGAAGGCCGAGGCGGG + Intergenic
1165618117 19:37220011-37220033 ATTCTTTGGAATTGTGTGGGTGG - Intronic
1165954533 19:39493917-39493939 ATACTTTGGAAGTCTGAGGCGGG - Intergenic
1167130121 19:47579646-47579668 ATACTTTGGAAGGCCGAGGCAGG - Intergenic
1167162500 19:47777521-47777543 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
925726973 2:6882697-6882719 ATGTTTTGGAATTTCAAGACCGG - Intronic
927970139 2:27300621-27300643 ATACTTTAGAAGAGCGAGGCAGG + Intronic
928282671 2:29962955-29962977 ATTCTTGGGAATTGAGAGACTGG + Intergenic
929451195 2:42038769-42038791 ATGCTTTGGAAGGCCAAGGCAGG + Intergenic
930061377 2:47291978-47292000 ATACTTTGGAAGGCCGAGGCAGG + Intergenic
930998483 2:57752102-57752124 ATGCTATGGAATTCAGAGGAAGG + Intergenic
932340387 2:70959645-70959667 GTGCTTTGGAAGTGGCAGGCAGG - Intronic
933656087 2:84888076-84888098 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
933693325 2:85196484-85196506 ATGATTTGGAATGTCCAGGCCGG + Intronic
936008039 2:108907397-108907419 GTGCTTTGGAAGGCCGAGGCGGG + Intronic
936600277 2:113889161-113889183 ATGCTTTGGAAGGCCGAGGTGGG - Intergenic
939490180 2:142867578-142867600 ATGCTTTGGGATGCTGAGGCAGG - Intergenic
939601637 2:144199293-144199315 ATACTTTGGGAATCCGAGGCGGG - Intronic
940896214 2:159084003-159084025 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
941393260 2:164942713-164942735 ATGCTTTGGAGTTTGGGGGCTGG + Intronic
942723189 2:178976484-178976506 ATGTTTTGGAAATGCAAGGAAGG + Intronic
943563355 2:189489443-189489465 GTGCTTTGGAAGGCCGAGGCAGG + Intergenic
944121708 2:196247608-196247630 TTGCTTTGTCATTGCTAGGCAGG + Intronic
946437602 2:219668277-219668299 GTGCTTTGGAAGGCCGAGGCGGG - Intergenic
947114960 2:226759926-226759948 ACGTTTTGGGAGTGCGAGGCAGG + Intronic
947138837 2:227001924-227001946 ATGCTTTGGAAGGCTGAGGCAGG + Intergenic
947959527 2:234223440-234223462 ATGCTTTGGATTTGAGAGCTGGG + Intergenic
948820533 2:240541746-240541768 GTGCTTTGGAAGGCCGAGGCAGG - Intronic
1169993295 20:11527272-11527294 GTGCTTTGGGAGTCCGAGGCAGG + Intergenic
1170852078 20:20014062-20014084 ATGCTTTGGGAGGCCGAGGCGGG - Intergenic
1171077589 20:22144478-22144500 ATGCTTTGGGAGTCCGAAGCAGG - Intergenic
1172088889 20:32412803-32412825 ACACTTTGGAATGGCAAGGCGGG - Intronic
1173641812 20:44608554-44608576 ACACTTTGGAAGTCCGAGGCAGG + Intronic
1173722014 20:45267725-45267747 ATGCTTTGGGAGACCGAGGCGGG + Intergenic
1173947428 20:46962907-46962929 GTGCTTTGGACTTGCCACGCAGG - Intronic
1174954791 20:55085620-55085642 ATGCTTTGGAATGGAGAGAGAGG + Intergenic
1176149764 20:63584360-63584382 ATGCTTTGGGAGGCCGAGGCTGG + Intergenic
1178472064 21:32902730-32902752 TTGCTATGGGATTGCAAGGCAGG + Intergenic
1178592426 21:33922604-33922626 GTGCTTTGGAAGGTCGAGGCAGG + Intergenic
1179433532 21:41343580-41343602 ATGCTTTGGAATAGCGAACACGG - Intronic
1180595831 22:16972651-16972673 ATGTTTTGGGCTTGAGAGGCTGG - Intronic
1185188041 22:49414778-49414800 ATGCTTTGGAAATCTGAGGCAGG - Intronic
950181802 3:10918638-10918660 ATGCCTTGGATTTGGGAGGGAGG - Intronic
950992501 3:17454704-17454726 ATACTTTGGGATGCCGAGGCAGG - Intronic
951633307 3:24744779-24744801 ATGCTTTGGGAGGCCGAGGCAGG + Intergenic
952607078 3:35161314-35161336 ATGCTTTGGAAGGCAGAGGCAGG - Intergenic
953116063 3:39993569-39993591 ATGGTTTAGGATTGCCAGGCAGG - Intronic
953494847 3:43377330-43377352 GTGCTTTGGAAGGCCGAGGCAGG - Intronic
954020366 3:47735406-47735428 ATACTTTGGGAGGGCGAGGCTGG + Intronic
954470701 3:50692161-50692183 ATGTTTTGGAACCCCGAGGCAGG - Intronic
954663847 3:52240000-52240022 ACGCTTTGGGAGTCCGAGGCGGG - Intergenic
954725381 3:52604452-52604474 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
955805061 3:62725092-62725114 AAGATTGGGAATTCCGAGGCTGG - Intronic
956445083 3:69318219-69318241 ATACTTTGGAAGTCCAAGGCGGG - Intronic
956879053 3:73491845-73491867 ATGCTTTGGAAGGCTGAGGCAGG - Intronic
957035138 3:75287414-75287436 AAGCTTTGCAATTTTGAGGCAGG - Intergenic
957635171 3:82774356-82774378 GTACTTTGGGATGGCGAGGCAGG - Intergenic
960037551 3:113117104-113117126 ATACTTTGGAAGGGTGAGGCAGG - Intergenic
961079022 3:124009011-124009033 AAGCTTTGCAATTTTGAGGCAGG - Intergenic
961304456 3:125947461-125947483 AAGCTTTGCAATTTTGAGGCAGG + Intergenic
962208822 3:133459091-133459113 GTGCTTTGGAATGCGGAGGCAGG + Intronic
962866228 3:139449858-139449880 ATGCTTTGGATGAACGAGGCTGG + Intergenic
966301189 3:178481129-178481151 ATGCGTTGGAATAGAGATGCTGG - Intronic
967517727 3:190390288-190390310 ATACTTTGGAAGGCCGAGGCGGG + Intronic
969315782 4:6380746-6380768 ATGCTTTGGAATGCCGAGGTGGG - Intronic
970422786 4:15920648-15920670 ATGCATGGGAAATGTGAGGCTGG + Intergenic
971422491 4:26486665-26486687 ACGCTTTGGGAGTCCGAGGCAGG + Intronic
972134350 4:35873364-35873386 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
972591788 4:40494883-40494905 ATGCTTTGGAATTTCCAGTTAGG + Intronic
976229503 4:82826597-82826619 ATGCTTTGGGAAGCCGAGGCGGG - Intronic
976291690 4:83425031-83425053 ATGCTTTGGGAGAACGAGGCGGG + Intronic
978568763 4:110113331-110113353 ATGCTTTGGGAGGGCAAGGCGGG + Intronic
979316275 4:119267919-119267941 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
980734970 4:136872838-136872860 ATGCTTTGGGAGTCCGAGGCAGG - Intergenic
982199227 4:152943675-152943697 CTGCCTTGGAAATGCTAGGCAGG + Intronic
982637016 4:157909585-157909607 ATGTTTGGGAATTGAGAGCCTGG - Intergenic
983570668 4:169204793-169204815 ATGCTTTGGGAGGCCGAGGCGGG - Intronic
984566735 4:181339993-181340015 ACACTTTGGAATGCCGAGGCAGG - Intergenic
985620186 5:950738-950760 AGGTTTTGGAATTACCAGGCAGG - Intergenic
987645277 5:20662947-20662969 ATGCTTTGGGAGGCCGAGGCCGG - Intergenic
989024169 5:37046737-37046759 ATGTTTTGCAATTGTTAGGCAGG + Intronic
989621029 5:43384534-43384556 ATACTATGGAATTGCGAGTAGGG - Intronic
989716917 5:44475055-44475077 ATGCTTTGGAAGGCCAAGGCAGG - Intergenic
993782229 5:92081470-92081492 ATCCTTTGGGAGGGCGAGGCGGG - Intergenic
993949968 5:94162537-94162559 ATGCTTTGGGATGCCAAGGCAGG - Intronic
997497561 5:134342956-134342978 ATGCTTTGGGAGTCCAAGGCAGG + Intronic
998304019 5:141054940-141054962 GTGCTTTGGGTTTCCGAGGCTGG - Intergenic
1000096878 5:157979006-157979028 ATGCTTTGGGAGGCCGAGGCAGG - Intergenic
1000623505 5:163511797-163511819 ACACTTTGGGAATGCGAGGCAGG - Intronic
1000761371 5:165229268-165229290 ATGCTTTTTAATGGCTAGGCTGG - Intergenic
1002114923 5:176952683-176952705 ATGCTTTGGGAAGACGAGGCGGG + Intronic
1003551702 6:7107285-7107307 ATGCCTCGGAATTGCGAGAGGGG - Intergenic
1004748915 6:18540712-18540734 ATACTTTGGGAGTCCGAGGCAGG - Intergenic
1005646749 6:27846638-27846660 ATGCTTTGGGAGGCCGAGGCGGG + Intronic
1013564222 6:111341292-111341314 GTGCTTTGGAATGCCGAGGCGGG - Intronic
1013801106 6:113944738-113944760 ATGCTTTGGAAGTCCGAGGTGGG - Intronic
1014280286 6:119435351-119435373 ATGCTTTGGGAGGCCGAGGCGGG + Intergenic
1015867557 6:137742428-137742450 ACACTTTGGGATTACGAGGCAGG + Intergenic
1015947316 6:138516043-138516065 CTGCTTTGCAAATGCTAGGCCGG - Intronic
1017387077 6:153898896-153898918 ATATTGTGGAATTGAGAGGCAGG + Intergenic
1017906007 6:158757899-158757921 CTGGTTTGGAATTGCACGGCGGG + Intronic
1018312043 6:162520001-162520023 ATGCTTTGGAAGGCCAAGGCAGG + Intronic
1019949855 7:4362521-4362543 ATGCTTTGGAAGGCCAAGGCAGG + Intergenic
1020155340 7:5718791-5718813 ATGCTTTGGAAGGCCGAGGTGGG - Intronic
1021528315 7:21614071-21614093 ATGCTTTGGAATTGCGAGGCTGG - Intronic
1022012393 7:26320226-26320248 ATACTTTGGGAGGGCGAGGCAGG - Intronic
1022930897 7:35113057-35113079 ATGCTCTGGATTTTCTAGGCAGG - Intergenic
1023053789 7:36275704-36275726 ATACTTTGGAAGGGCGAAGCGGG - Intronic
1023383423 7:39631252-39631274 GTGCTTTGGAAGGCCGAGGCAGG - Intronic
1023921468 7:44633387-44633409 ATGCTTTGTAAGTCAGAGGCAGG + Intronic
1024665768 7:51545464-51545486 TTGATTTGGAAGTGCCAGGCAGG + Intergenic
1026088905 7:67283958-67283980 ATGCGTTGGTATTGCCAGGAGGG - Intergenic
1026725349 7:72866389-72866411 ATGCATTGGTATTGCCAGGAGGG + Intergenic
1026747437 7:73024248-73024270 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1026751087 7:73052387-73052409 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1026754736 7:73080501-73080523 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1026758388 7:73108535-73108557 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1027033643 7:74909540-74909562 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1027089017 7:75284950-75284972 ATGCGTTGGTATTGCCAGGAGGG - Intergenic
1027092660 7:75312878-75312900 ATGCGTTGGTATTGCCAGGAGGG - Intergenic
1027096303 7:75340845-75340867 ATGCGTTGGTATTGCCAGGAGGG - Intergenic
1027118495 7:75499276-75499298 ATGCGTTGGTATTGCCAGGAGGG - Intergenic
1027273304 7:76536190-76536212 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1027323039 7:77026847-77026869 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1027326748 7:77055254-77055276 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1029188686 7:98756770-98756792 ATGCTTTGGAAGGCCGAGGCAGG - Intergenic
1029397308 7:100317115-100317137 ATGCGTTGGTATTGCCAGGAGGG - Exonic
1029485626 7:100838245-100838267 ATGCTTTGGAAGGTGGAGGCAGG - Intronic
1029520074 7:101054580-101054602 ATGCTTTGGGAGGCCGAGGCTGG + Intronic
1029718995 7:102350746-102350768 ATGCGTTGGTATTGCCAGGAGGG + Intergenic
1029753620 7:102558512-102558534 ATGCGTTGGTATTGCCAGGAGGG - Exonic
1029771568 7:102657596-102657618 ATGCGTTGGTATTGCCAGGAGGG - Exonic
1029826800 7:103205570-103205592 ATGCTCTGGATTTTCTAGGCAGG - Intergenic
1030332301 7:108284116-108284138 ATAATTTGGAAATGAGAGGCTGG - Intronic
1032693800 7:134316437-134316459 ATGCTTTGAAACTGTTAGGCGGG + Intronic
1034654323 7:152717128-152717150 GTGCTTTGGAAAGCCGAGGCAGG - Intergenic
1036541766 8:9721033-9721055 ATACTTTGGGATGCCGAGGCAGG + Intronic
1037058769 8:14479989-14480011 GTGCTTTGGGATGCCGAGGCGGG - Intronic
1038208026 8:25487493-25487515 ATGCTTTGGGAGGCCGAGGCAGG + Intronic
1038534157 8:28342096-28342118 GTGCTTTGGGATGCCGAGGCTGG + Intronic
1039841764 8:41298659-41298681 ATGCTTTGGGAGGGTGAGGCAGG - Intronic
1041207670 8:55514501-55514523 ATGCTTTGGGAGGCCGAGGCGGG - Intronic
1041249292 8:55918950-55918972 GTGCTTTGGGAGTTCGAGGCAGG + Intronic
1042958828 8:74280812-74280834 ATGCTCCGTAATTGCAAGGCAGG - Intronic
1044339434 8:91029722-91029744 ATGCTTTGGGAGACCGAGGCAGG + Intronic
1045487571 8:102644114-102644136 ATGCTTTGGAAGACCAAGGCAGG - Intergenic
1047925337 8:129677185-129677207 ACGCTTTGGAAGGCCGAGGCAGG + Intergenic
1048847217 8:138613000-138613022 ATACTTTGGGAGGGCGAGGCGGG + Intronic
1049550611 8:143256629-143256651 GTGCTTTGGAAGGCCGAGGCAGG + Intronic
1050753980 9:8977269-8977291 ATGCTTTGAAATTGTGAATCTGG - Intronic
1053465374 9:38303462-38303484 ACACTTTGGAAGTCCGAGGCAGG + Intergenic
1058611242 9:106778049-106778071 ATGCTTTGGAATTACAAAGGAGG + Intergenic
1058812298 9:108652764-108652786 GTGTTTTGGAATTGAGATGCAGG + Intergenic
1059103298 9:111490007-111490029 GTGCTTTGGGATGCCGAGGCAGG + Intergenic
1060834396 9:126744226-126744248 ATGCTTTGGGATGCTGAGGCAGG - Intergenic
1185623638 X:1468182-1468204 ATGCTTTGGGAGGCCGAGGCAGG - Intronic
1185869357 X:3650630-3650652 ATGCTTTGGAAGGTCGCGGCAGG + Intronic
1185911647 X:3986525-3986547 ATGCTTTGGGAGGTCGAGGCAGG + Intergenic
1187516461 X:19975733-19975755 ATGCTTTGAAAGGCCGAGGCAGG - Intergenic
1193935225 X:87610125-87610147 AGGCTTTGGGATGGGGAGGCTGG - Intronic
1195086890 X:101421429-101421451 ATGGATTGGAATTGGGAGGGAGG + Intronic
1195368495 X:104149984-104150006 ATACTTTGGGAGTCCGAGGCGGG + Intronic
1196739017 X:119007727-119007749 ATGCGTTGGGATTGGGAGGAGGG + Intronic
1198222431 X:134614895-134614917 ATGCTTTGGGAGGCCGAGGCAGG - Intronic