ID: 1021528484

View in Genome Browser
Species Human (GRCh38)
Location 7:21616774-21616796
Sequence GAACTGAGCCTATTGTAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 69}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021528483_1021528484 -1 Left 1021528483 7:21616752-21616774 CCAAGGGGGCTCAACATATACAG 0: 1
1: 0
2: 0
3: 7
4: 59
Right 1021528484 7:21616774-21616796 GAACTGAGCCTATTGTAATTTGG 0: 1
1: 0
2: 1
3: 4
4: 69
1021528482_1021528484 0 Left 1021528482 7:21616751-21616773 CCCAAGGGGGCTCAACATATACA 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1021528484 7:21616774-21616796 GAACTGAGCCTATTGTAATTTGG 0: 1
1: 0
2: 1
3: 4
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021528484 Original CRISPR GAACTGAGCCTATTGTAATT TGG Intronic
906012688 1:42543623-42543645 GAACTGAGTATAGAGTAATTTGG - Intronic
908568912 1:65388174-65388196 AAGCTGAGCCTATTCTAACTGGG + Intronic
910425615 1:87117545-87117567 GGACGGAGCCTATTGTTAATTGG + Intronic
912713115 1:111963693-111963715 GAACTGAGCCTACCGTCATGAGG + Intronic
913685983 1:121232414-121232436 GAACTGAGCAAGATGTAATTGGG + Intronic
914037835 1:144020017-144020039 GAACTGAGCAAGATGTAATTGGG + Intergenic
914151619 1:145047915-145047937 GAACTGAGCAAGATGTAATTGGG - Intronic
920473306 1:206250971-206250993 GAACTGAGCAAGATGTAATTGGG + Intronic
924189239 1:241532241-241532263 GAGCTGAGCTGATTGTACTTTGG + Exonic
1074540230 10:114359133-114359155 GAACTGAGACCACTGTGATTAGG + Intronic
1075993646 10:126859332-126859354 GAACTGAGCCTTTTATAACTTGG + Intergenic
1082085616 11:48047336-48047358 GTCCTGTGCCTGTTGTAATTTGG + Intronic
1085852232 11:80135136-80135158 GAATTGAGACTTTTGTCATTAGG + Intergenic
1094759811 12:33518726-33518748 AAAAAGAGCCTATTATAATTTGG + Intergenic
1106926689 13:34620696-34620718 GATATGAGCCTATTAAAATTCGG + Intergenic
1108257285 13:48622953-48622975 GAACTGAGACTTTTGTGTTTGGG - Intergenic
1110588690 13:77227387-77227409 GAACTGAGTATATTTTATTTTGG - Intronic
1111055309 13:82941197-82941219 GAACTGTGGCTAGTATAATTGGG - Intergenic
1114382820 14:22226178-22226200 GAACTGAGGTTATTCTCATTTGG + Intergenic
1114790446 14:25651918-25651940 GAAAAGGGACTATTGTAATTGGG + Intergenic
1116824309 14:49657132-49657154 GTAGTCAGCCAATTGTAATTGGG + Intronic
1117501195 14:56353321-56353343 AAGGTAAGCCTATTGTAATTGGG + Intergenic
1118384304 14:65243069-65243091 GAGCTGAGCCTGATGTAAATAGG + Intergenic
1122445482 14:101764420-101764442 GAACTGAACTCATTCTAATTTGG - Intronic
1134405753 16:13957211-13957233 GTACTGAGCTTACTGTAACTGGG + Intergenic
1138616512 16:58171751-58171773 GAAATGTGCCTAGTGTGATTAGG + Intronic
1140382715 16:74504955-74504977 GAAAAGAGCCTATTGCATTTGGG + Intronic
1143574193 17:7780389-7780411 GAACTTAGACTATTGTCAGTAGG + Intronic
1145957351 17:28863755-28863777 AAGCTGAGCCTAATGTAATATGG + Intergenic
1163664734 19:18598018-18598040 GAATTGAGCCTAATCTAATTAGG - Intronic
926382885 2:12308682-12308704 GAACAGAGGCTGTTGCAATTAGG + Intergenic
928531806 2:32200212-32200234 GACCAGAGGCTATTCTAATTAGG - Intronic
933395428 2:81725070-81725092 GAACTAAGGCTATTGTAAAGTGG + Intergenic
941491727 2:166150952-166150974 AAACTAAGCCTTTTGTAATCAGG + Intergenic
1169531972 20:6495066-6495088 AATCTGAGCCTATTCTGATTAGG + Intergenic
1175710293 20:61214911-61214933 GAACTGATCCTATGGAAATGAGG - Intergenic
949470778 3:4393924-4393946 GAACTCAACCAAATGTAATTAGG + Intronic
952741901 3:36742174-36742196 CCACTGGTCCTATTGTAATTTGG - Intergenic
958506817 3:94989705-94989727 GAAATGTGCCTATTGAAAATTGG - Intergenic
962489866 3:135882890-135882912 GAAGAGAGCCTGATGTAATTTGG - Intergenic
963002353 3:140694271-140694293 GACCTGAGCCTAGTGGAGTTGGG - Intronic
963708952 3:148724153-148724175 CAACTGTGCCAATTGTAATGAGG - Intronic
965010070 3:163076494-163076516 TATCTGAGGCTATTGTAAATGGG - Intergenic
966458926 3:180152830-180152852 AAGCTGTGCCTATTGTTATTGGG + Intergenic
969025248 4:4167544-4167566 GAACAGAGCCTATTGAACTCTGG - Intergenic
978380314 4:108120900-108120922 GAAATGAGCCTATTGTTTTAAGG - Intronic
978812081 4:112860801-112860823 TGACTGGGGCTATTGTAATTTGG + Intronic
981359256 4:143828547-143828569 TAACGGCACCTATTGTAATTGGG - Intergenic
989135552 5:38151037-38151059 GTACTAATCCTATTGTATTTAGG + Intergenic
989491576 5:42061430-42061452 GAAATAAGCCTTGTGTAATTTGG + Intergenic
1008723503 6:54388085-54388107 ACACTGAGCCTATTCTCATTTGG - Intronic
1014181606 6:118390457-118390479 CAACTGAGCCTCTTGTATTAAGG - Intergenic
1015433961 6:133164309-133164331 GAACCAATCCTATTGTAATAAGG - Intergenic
1017424277 6:154304705-154304727 GAACTGAGCATGGTGTTATTAGG - Intronic
1021528484 7:21616774-21616796 GAACTGAGCCTATTGTAATTTGG + Intronic
1024645657 7:51368452-51368474 GAACTGAGCCTGCTGTATCTGGG + Intergenic
1027593128 7:80139254-80139276 CAAGAGAGCCTATTGGAATTAGG - Intronic
1030107180 7:105996955-105996977 GATCTGAGCCTATTGTAGATGGG + Intronic
1030758369 7:113318680-113318702 GAACTGAGCAGATTGTCTTTGGG + Intergenic
1030918569 7:115349660-115349682 GAACAGAGTCTACTTTAATTGGG + Intergenic
1031912155 7:127529213-127529235 GCACTGTGGCTATTGTAAATGGG - Intergenic
1042448067 8:68912265-68912287 AAATTAAGCCTATTGTTATTGGG - Intergenic
1045556930 8:103223601-103223623 GAAATGACCCTATTGTAATTGGG + Intronic
1051502120 9:17789281-17789303 AAACTTAGCCTATCTTAATTTGG + Intronic
1051834616 9:21321508-21321530 GGCCTGAGCCTTTTGGAATTTGG - Intergenic
1051841064 9:21398921-21398943 GGCCTGAGCCTTTTGGAATTTGG + Intergenic
1185777625 X:2817764-2817786 AAACTGAGCCTATTTCCATTTGG - Intergenic
1186570623 X:10711507-10711529 GAACTGTTCCTATTGTATATGGG - Intronic
1189920482 X:45898467-45898489 GAACTGAGTGAATTTTAATTTGG + Intergenic
1191102561 X:56747785-56747807 GAACTCAGCCAATGGTAGTTGGG + Intergenic
1194524427 X:94960842-94960864 GAACTGAGCCTTTTGTCTTTTGG - Intergenic
1197009326 X:121541841-121541863 GACCTGAGCTTATTGTATTGTGG + Intergenic
1197149295 X:123202760-123202782 AAACTGGGCCTATTGTATCTGGG + Intronic
1198343503 X:135737490-135737512 GAACTGTGGCTAATATAATTCGG + Intergenic
1199022733 X:142901130-142901152 GAACTGAGCCTAATTTAAAGAGG - Intergenic