ID: 1021529857

View in Genome Browser
Species Human (GRCh38)
Location 7:21632243-21632265
Sequence GAGGCCTCCAGGACTGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1642
Summary {0: 1, 1: 0, 2: 12, 3: 509, 4: 1120}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021529851_1021529857 -9 Left 1021529851 7:21632229-21632251 CCCCTTTTTCCTCTGAGGCCTCC 0: 3
1: 10
2: 126
3: 592
4: 1698
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120
1021529848_1021529857 0 Left 1021529848 7:21632220-21632242 CCCAGGAAACCCCTTTTTCCTCT 0: 1
1: 1
2: 50
3: 465
4: 1516
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120
1021529849_1021529857 -1 Left 1021529849 7:21632221-21632243 CCAGGAAACCCCTTTTTCCTCTG 0: 1
1: 0
2: 7
3: 101
4: 845
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120
1021529845_1021529857 12 Left 1021529845 7:21632208-21632230 CCCTGGGCCTGGCCCAGGAAACC 0: 68
1: 390
2: 875
3: 1339
4: 1691
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120
1021529846_1021529857 11 Left 1021529846 7:21632209-21632231 CCTGGGCCTGGCCCAGGAAACCC 0: 1
1: 71
2: 460
3: 1025
4: 1871
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120
1021529852_1021529857 -10 Left 1021529852 7:21632230-21632252 CCCTTTTTCCTCTGAGGCCTCCA 0: 1
1: 1
2: 20
3: 330
4: 2596
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120
1021529847_1021529857 5 Left 1021529847 7:21632215-21632237 CCTGGCCCAGGAAACCCCTTTTT 0: 1
1: 19
2: 244
3: 688
4: 1800
Right 1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG 0: 1
1: 0
2: 12
3: 509
4: 1120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021529857 Original CRISPR GAGGCCTCCAGGACTGAGAT GGG Intronic
900484180 1:2913731-2913753 AAGACCTCGAGGACTGAGCTGGG - Intergenic
900730789 1:4258278-4258300 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
900738362 1:4314501-4314523 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
900817303 1:4858440-4858462 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
901885927 1:12222904-12222926 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
901925430 1:12563274-12563296 TAGGCCTCCAGGCCTATGATGGG - Intergenic
902084741 1:13850413-13850435 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
902813104 1:18900747-18900769 GAGGCCTCCTGAATTGAGAGGGG - Intronic
903369007 1:22822940-22822962 GAGGCCTCCAGGAGACAGTTTGG + Intronic
903680113 1:25090866-25090888 GAGCACTTCAGGACTGAGCTGGG + Intergenic
903772217 1:25771079-25771101 GAGGCCACCAGGGCAGAGAGGGG + Intronic
904057441 1:27680655-27680677 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
904158035 1:28501157-28501179 GAGGCCACCTGGACTGAAACTGG - Intergenic
904278991 1:29405270-29405292 TAGGCCTCTGGGACTGTGATAGG - Intergenic
904958985 1:34316136-34316158 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
906206553 1:43990529-43990551 AGGACCTCCAGGACTGAGACTGG + Exonic
906369645 1:45241671-45241693 TAGGCCTCCTGGCCTGTGATGGG + Intronic
906370738 1:45251267-45251289 GTGGACTCCAGAACTGAGATAGG + Intronic
906371539 1:45258200-45258222 TAGACCTCCAGGCCTGTGATGGG - Intronic
906664375 1:47608714-47608736 TAGACCTCCAGGCCTGTGATGGG + Intergenic
906764025 1:48409889-48409911 TAGGCCTCAAGGCCTGTGATGGG + Intronic
906937261 1:50225423-50225445 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
907267754 1:53273034-53273056 GAGTCCTCCAGGGCTCAGGTGGG + Intronic
907405731 1:54252383-54252405 GAGGCTTTTAGGATTGAGATGGG + Intronic
907707828 1:56847831-56847853 TAGGCCTTCAGGACTGTGTTGGG + Intergenic
907726970 1:57029057-57029079 TGGGCCTCCAGGCCTGTGATGGG - Intronic
907749198 1:57246201-57246223 CAGGCCTCTAGGCCTGTGATGGG - Intronic
908004377 1:59712774-59712796 TAGGCCTCCAGGCTTGTGATGGG + Intronic
908006877 1:59736905-59736927 TAAGCCTCCAGGCCTGTGATGGG - Intronic
908020046 1:59889668-59889690 TATGCCTCCAGGCCTGTGATGGG + Intergenic
908210486 1:61895357-61895379 TAGGCCTCTGGGACTGTGATGGG - Intronic
908487705 1:64611177-64611199 GAGGCCTCTGGGCCTGTGATGGG + Intronic
908746886 1:67384460-67384482 TAGGCCTCCAGGCCTGTGATGGG + Intronic
908871752 1:68620769-68620791 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
908932329 1:69331813-69331835 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
908933008 1:69340192-69340214 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
909044342 1:70690905-70690927 TAGGCCTCCAGTCCTGTGATGGG - Intergenic
909086262 1:71172822-71172844 TAGGACTCCAGGCCTGTGATGGG + Intergenic
909133405 1:71767745-71767767 TAGGCCTCCAGGTCTGTGATGGG - Intronic
909192550 1:72572845-72572867 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
909371158 1:74885008-74885030 TAGGCCTCCAGACCTGTGATGGG - Intergenic
909373517 1:74914216-74914238 TAGACCTCCAGGCCTGTGATTGG + Intergenic
909422797 1:75485003-75485025 CAGGCCTCCAGGCCTGTGATAGG + Intronic
909436331 1:75647069-75647091 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
909755484 1:79220674-79220696 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
909757093 1:79240068-79240090 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
909834066 1:80231394-80231416 TAGGCCTCCAGGCCTGTGACGGG + Intergenic
909867077 1:80686567-80686589 TAGGCCTCCAGACCTGTGATGGG + Intergenic
910245605 1:85135101-85135123 GAGGCCAGCATGACTGGGATGGG - Intergenic
910726895 1:90349281-90349303 TAGACCTCCAGGCCTGTGATGGG - Intergenic
911007661 1:93243452-93243474 TAGGCCTCCAGGCCTGTGATGGG + Intronic
911023092 1:93408378-93408400 TAGGCCTCCGGGTCTGTGATGGG - Intergenic
911235086 1:95403980-95404002 TAGGCCTCCAGGCCTGTTATGGG - Intergenic
911309446 1:96275470-96275492 TAGGCCTCCAGACCTGTGATGGG - Intergenic
911331373 1:96529474-96529496 TAGGCCTCCAGGCCTCTGATGGG - Intergenic
911333604 1:96554520-96554542 GAGGCCTACAGGAATGACAAGGG - Intergenic
911358452 1:96848979-96849001 TAGGCTTCCAGGTCTGTGATGGG - Intergenic
911376337 1:97056544-97056566 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
911490738 1:98563020-98563042 TAGGCCTCCAGACCTGTGATGGG - Intergenic
911515827 1:98866796-98866818 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
911530418 1:99037004-99037026 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
911780307 1:101868714-101868736 TAGGCCTCCAGGCTTGTGATGGG - Intronic
911848478 1:102784139-102784161 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
912009910 1:104947148-104947170 TAGGCCTCAGGGACTGTGATGGG - Intergenic
912029881 1:105227682-105227704 TAGGCCTCTGGGCCTGAGATGGG - Intergenic
912099162 1:106184710-106184732 TAGGCCTCCAGGTCTGCGATGGG - Intergenic
912112709 1:106363304-106363326 TAGTCCTCCAGGCCTGTGATGGG - Intergenic
912121650 1:106479308-106479330 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
912279500 1:108298008-108298030 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
912288726 1:108396349-108396371 TGGGCCTCCAGGCCTGTGATGGG - Intronic
912907131 1:113718838-113718860 TAGGCCTCCAGGCCTGTGAAGGG + Intronic
913208497 1:116563791-116563813 AAGGCCTCCAGGCCTGTGATAGG + Intronic
913289498 1:117259024-117259046 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
915584850 1:156838969-156838991 GAGGCCTCCAGGAGGGTGAAAGG - Intronic
915593677 1:156884443-156884465 GGGGCCTCCAGCACTGGGATGGG + Intergenic
916384808 1:164255485-164255507 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
916948924 1:169759051-169759073 TAGGCCTCCAGGCCTGTGATGGG + Intronic
916959180 1:169872130-169872152 TAGGCCTGCAGGCCTGTGATGGG - Intronic
916993028 1:170265452-170265474 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
917035494 1:170743297-170743319 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
917082598 1:171272020-171272042 TAGGCCTCCAGGCCTGTGATGGG - Intronic
917228931 1:172814655-172814677 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
917290799 1:173470780-173470802 TAGGCCCCCAGGCCTGTGATGGG - Intergenic
917396673 1:174601246-174601268 GGGGCCTCCAGGCCTGTGATGGG + Intronic
917547274 1:175984170-175984192 GGGGTCTCCAGGCCTGTGATGGG - Intronic
917578104 1:176345241-176345263 TAGGCCTCAAAGACTGTGATGGG + Intergenic
918591955 1:186249930-186249952 GAGGCCTCCAGGCCTGTGATGGG + Intergenic
918718189 1:187818357-187818379 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
918752505 1:188290181-188290203 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
918897570 1:190367430-190367452 TAGGCCTCCAGGCCTGTGATAGG + Intronic
918936590 1:190929625-190929647 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
918955857 1:191205929-191205951 TAGGCATCCAGGCCTGTGATGGG - Intergenic
919056016 1:192570284-192570306 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
919175113 1:194010230-194010252 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
919211772 1:194495905-194495927 TAGGTCTCCAGGCCTGTGATAGG + Intergenic
919277523 1:195439937-195439959 TAGGTCTCCAGGCCTGTGATAGG + Intergenic
919366588 1:196669408-196669430 GAGGCAACCAGGCCTGTGATGGG - Intronic
919460603 1:197872286-197872308 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
919554344 1:199031872-199031894 TCGGCCTCCAGGTCTGTGATGGG + Intergenic
919593541 1:199533540-199533562 TAGGCCTCCAGGCCTGCCATGGG - Intergenic
921260906 1:213384423-213384445 GGAGCCTCCAGGTCTGTGATGGG + Intergenic
921424311 1:214984684-214984706 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
921531212 1:216285185-216285207 TAGGCCTCCAGGCCTGTGATGGG - Intronic
921621475 1:217330383-217330405 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
921765921 1:218972837-218972859 GAGGCCTCTGGGCCTGTGATGGG - Intergenic
921880464 1:220249665-220249687 TAGGCCTCCGGGCCTGTGATGGG - Intronic
921996630 1:221426222-221426244 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
922393984 1:225177521-225177543 TAGGCCTCCAGGCCTGTGATGGG - Intronic
923069265 1:230547889-230547911 GAGGCCTGCAGGACAGAAAAAGG - Intergenic
923088704 1:230722017-230722039 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
923198044 1:231686589-231686611 TGGGCCTCCAGGCCTGTGATGGG + Intronic
923339207 1:232993700-232993722 TAGGCCTCCAGGCCTGTGATGGG - Intronic
923535912 1:234851710-234851732 GAGGACTCCAGGACTCATAGCGG + Intergenic
923890982 1:238214636-238214658 TGGGCCTCCAGGTCTGTGATGGG + Intergenic
923919387 1:238546339-238546361 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
924050771 1:240078023-240078045 AAGGCCTCCAGGCCTGTGATGGG - Intronic
924152470 1:241142665-241142687 TAGGCCTCCAGGCCTGTGATGGG + Intronic
924208014 1:241734171-241734193 GAGGCTTCCAGGACACAGGTAGG - Intronic
924806546 1:247366231-247366253 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1063808936 10:9681453-9681475 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
1064059152 10:12122799-12122821 GAGGCCCCCAGCACTGAGTCAGG - Exonic
1065347793 10:24765211-24765233 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1065408090 10:25390874-25390896 TGGGCCTCCAGGCCTGTGATGGG - Intronic
1065534175 10:26701377-26701399 TAGGCCTCCTGGCCTGTGATGGG - Intronic
1066058553 10:31703077-31703099 TAGGCCTCCGGGCCTGTGATGGG - Intergenic
1066083446 10:31954973-31954995 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1066451821 10:35536996-35537018 TAGACCTCCAGGCCTGTGATGGG - Intronic
1067206059 10:44215102-44215124 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1067790919 10:49287064-49287086 GAGGCCTCCAAGACACAGGTGGG - Intergenic
1068011328 10:51455286-51455308 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1068125035 10:52828518-52828540 GAGCCCTCTAGTACTGAAATGGG + Intergenic
1068449381 10:57165855-57165877 TAGGCCTCCAGGCCTGAGATGGG + Intergenic
1068495105 10:57776901-57776923 TAGGCCCCCAGGCCTGTGATGGG + Intergenic
1068519083 10:58059599-58059621 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1068519518 10:58063064-58063086 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1069077408 10:64052457-64052479 GAGACCTCCAGGCCTGTGATGGG + Intergenic
1069166457 10:65166547-65166569 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1069754587 10:70765907-70765929 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1069959285 10:72070201-72070223 GGGGTTTCCAGGACTGAGGTGGG - Intronic
1070245821 10:74730481-74730503 TAGGCCTCCAGGGCTGTGATGGG - Intergenic
1070651814 10:78243021-78243043 TGGGCCTCCAGGTCTGTGATGGG - Intergenic
1071003119 10:80853743-80853765 CAGGCTTCCTGAACTGAGATGGG + Intergenic
1071034818 10:81232792-81232814 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1071035515 10:81239345-81239367 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1071061189 10:81571555-81571577 GGAGGCTCCAGGACTGAGAGGGG + Intergenic
1071159258 10:82727302-82727324 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1071506933 10:86238240-86238262 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1071981065 10:91004627-91004649 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1071990178 10:91093621-91093643 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1072647443 10:97267873-97267895 TACGCCTCCAGGCCTGTGATGGG + Intronic
1073545059 10:104340686-104340708 GGGGTCTCCAGGTGTGAGATAGG + Intergenic
1073883320 10:108008108-108008130 TAGACCTCCAGGCCTGTGATGGG + Intergenic
1073942349 10:108713343-108713365 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
1073964858 10:108977734-108977756 TAGGCCTGCAGGCCTGTGATGGG - Intergenic
1073993961 10:109294847-109294869 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1074041461 10:109793543-109793565 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1074069103 10:110048953-110048975 CATGCCTCCAGGCCTGTGATGGG - Intronic
1074260451 10:111848400-111848422 GAGGCCTTCAGACCTGTGATTGG - Intergenic
1074854699 10:117464968-117464990 GAGGTCACCAGGCCTGAGAGTGG + Intergenic
1074965794 10:118489909-118489931 TAGGCCTCCAAGCCTGCGATGGG - Intergenic
1075354304 10:121756814-121756836 TAGGTCTCCAGGCCTGTGATGGG + Intronic
1075530596 10:123225647-123225669 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1075938030 10:126360175-126360197 TAGGTCTCCAGGCCTGTGATGGG + Intronic
1076312995 10:129521575-129521597 GACTCCTGCAGGACTGAGGTGGG - Intronic
1076604887 10:131682936-131682958 GTGGCCTCATGGACAGAGATGGG + Intergenic
1077297899 11:1834663-1834685 GAGACCCCCAGGGATGAGATGGG + Intronic
1077985077 11:7343095-7343117 TAGGCCTCTAGGCCTGTGATGGG + Intronic
1078379747 11:10829389-10829411 TAGGCCTCCAGGTCTGTGATGGG + Intronic
1078516005 11:12023177-12023199 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1078687382 11:13546261-13546283 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1078834854 11:15017495-15017517 TAGGCCTCCGGGCCTGTGATGGG - Intronic
1079521128 11:21328150-21328172 TAAGCCTCCAGGCCTGTGATGGG - Intronic
1079537023 11:21526858-21526880 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1079542589 11:21593968-21593990 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1079716689 11:23756664-23756686 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
1079744367 11:24106698-24106720 TAGGTCTCCAGGCCTGTGATTGG - Intergenic
1079798905 11:24844632-24844654 TAAGCCTCCAGGCCTGTGATGGG - Intronic
1079881186 11:25929076-25929098 GAGGCTTCCATTACTGATATTGG - Intergenic
1079916156 11:26371076-26371098 TAGGCCTCCAGGCCTGCGATGGG - Intronic
1079949481 11:26784133-26784155 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1080151418 11:29056647-29056669 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1080153331 11:29078509-29078531 TGGGCCTCCAGGGCTGTGATGGG - Intergenic
1080264390 11:30386305-30386327 TAGGCCTCTAGGCCTGTGATGGG - Intronic
1080341777 11:31273091-31273113 TAGGCCTCCAGGCTTGTGATGGG + Intronic
1080746006 11:35109378-35109400 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
1080868168 11:36213614-36213636 GAGGCATGCAGGAGTGAAATGGG + Intronic
1081101454 11:39007231-39007253 CAGGCCTCCAGGCCTGTGATGGG + Intergenic
1081122708 11:39286027-39286049 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1081309497 11:41553376-41553398 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1081316603 11:41637829-41637851 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1081325472 11:41738679-41738701 TATGCCTCCAGGCCTGTGATTGG + Intergenic
1081441518 11:43086090-43086112 TAGACCTCCAGGCCTGTGATGGG + Intergenic
1081761202 11:45577440-45577462 GAGGCCTCCAGAGCTGGGATAGG - Intergenic
1081768993 11:45635683-45635705 TAGGCCTCCTGGACTATGATGGG - Intergenic
1082119053 11:48358107-48358129 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1082766233 11:57169941-57169963 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1083136155 11:60678437-60678459 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1083224069 11:61273663-61273685 GAGCCCTTCAGGACTGAGTCAGG + Intronic
1083506235 11:63160236-63160258 TAGGCCTCCAGGCCTGTGATAGG - Intronic
1083618708 11:64038566-64038588 GAGGCCTCCAGGATCTAGCTGGG + Intronic
1083685264 11:64371529-64371551 GAGGCCTCCGGGAGTGAGCCGGG - Exonic
1083900702 11:65641960-65641982 GAGGGCTCCAGGACATAGAAGGG + Intronic
1084130268 11:67128244-67128266 GAGGCCTCCAGGCAGGAGAGAGG - Intronic
1084409176 11:68996688-68996710 GAGGCCTCCAGCACTGGAGTGGG - Intergenic
1084499969 11:69529695-69529717 GAGGACGTCAGAACTGAGATTGG + Intergenic
1084941569 11:72615969-72615991 CAGGCCTCCAGCTCTGAGTTTGG + Intronic
1085236451 11:75019332-75019354 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1085418349 11:76334944-76334966 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1085588176 11:77731567-77731589 TAGGCCTCCAGGCCTGTGATAGG - Intronic
1085600904 11:77855163-77855185 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1085754990 11:79194907-79194929 TGGGCCTCCAGGGCTGTGATGGG - Intronic
1085986336 11:81792602-81792624 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1086014750 11:82154102-82154124 GAGGGCTCCAGTACAGAGCTAGG + Intergenic
1086084930 11:82944422-82944444 TAGGCCTCCAAGACTGTGATGGG + Intronic
1086184999 11:84002708-84002730 TAGGCCTCCAGGTCTGTCATGGG + Intronic
1086334120 11:85782379-85782401 TAGGCCTCCAGACCTGTGATGGG + Intronic
1086620623 11:88883695-88883717 TAAGCCTCCAGGCCTGTGATGGG - Intronic
1086750680 11:90490022-90490044 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1086764283 11:90675643-90675665 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1086826784 11:91508115-91508137 GAGGCCTCCAGGCCTGTGATGGG + Intergenic
1086828822 11:91534301-91534323 CAGACCTCCAGGCCTGTGATGGG - Intergenic
1087126055 11:94626573-94626595 TAGGCCTCCAAGACTGTGCTAGG + Intergenic
1087336547 11:96851665-96851687 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1087341764 11:96915889-96915911 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1087474582 11:98620218-98620240 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1087496328 11:98894468-98894490 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
1087578752 11:100025081-100025103 AAGGCCTCCAGGCCTTAGATGGG - Intronic
1087675574 11:101158001-101158023 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1087690716 11:101317751-101317773 TAGGCCTCCAGGTTTGTGATGGG + Intergenic
1087763623 11:102127273-102127295 TGGGCCTCCAGGCCTGTGATGGG - Intronic
1087793594 11:102432720-102432742 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1087807338 11:102569100-102569122 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1088038818 11:105351196-105351218 TAGGCCTCCAGGCCTGCAATGGG + Intergenic
1088048337 11:105480373-105480395 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1088096024 11:106102425-106102447 GGGGCCTTCAGAAATGAGATGGG + Intergenic
1088178574 11:107082436-107082458 GAGATCTCCAGGCCTGTGATGGG + Intergenic
1088426998 11:109714988-109715010 TAGGCCTCCAGGCCTCTGATGGG + Intergenic
1088443905 11:109902206-109902228 TAGGCCCCCAGGACTGTGATGGG + Intergenic
1088497030 11:110441864-110441886 TAGGCTTCCAGGCCTGTGATGGG - Intronic
1088953889 11:114598776-114598798 TAGGCCTGCAGGTCTGTGATGGG + Intergenic
1089131839 11:116218511-116218533 GAGGGCTCCAGAACTGAGGCAGG + Intergenic
1090595389 11:128315291-128315313 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
1090751597 11:129750784-129750806 CCGGCCTCCTGGACTGAGCTTGG + Intergenic
1090756390 11:129795300-129795322 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1091244575 11:134081351-134081373 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1091350672 11:134891765-134891787 TAGGCCTCCAAGTCTGTGATGGG - Intergenic
1091492256 12:943328-943350 TAGGGCTCCAGGCCTGGGATTGG - Intronic
1091552850 12:1550051-1550073 TAGGCCTCCAGGTCTGTGATGGG - Intronic
1091788274 12:3256248-3256270 GAAGCCCCCAGGACTGCTATCGG - Intronic
1092184332 12:6467704-6467726 TGGGCCTCCAGGCCTGTGATGGG - Intronic
1092618229 12:10234768-10234790 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1092665490 12:10791950-10791972 TAGGCCTCTGGGCCTGAGATGGG + Intergenic
1093038138 12:14352271-14352293 TATGCCTCCAGGCCTGTGATGGG + Intergenic
1093076118 12:14760707-14760729 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1093141892 12:15518376-15518398 CAGGCCTCCAGGCCTGTGATGGG + Intronic
1093244901 12:16724206-16724228 GAGGCCTTCTGAGCTGAGATAGG + Intergenic
1093297127 12:17404930-17404952 TAGGCCTTCAGGGCTGTGATTGG - Intergenic
1093478722 12:19583251-19583273 TAGGCCTCTAGGCCTGTGATGGG - Intronic
1093536699 12:20231137-20231159 TAGGCCTCAAGGCCTGTGATGGG + Intergenic
1094037018 12:26082257-26082279 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1094379905 12:29831387-29831409 TAGCCCTCCAGGCCTGTGATGGG + Intergenic
1094706026 12:32915320-32915342 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1094716148 12:33017193-33017215 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1094785818 12:33846998-33847020 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1095803491 12:46293322-46293344 TAGGCCTCCAGGCCCGTGATGGG + Intergenic
1095817469 12:46440457-46440479 GAGTCCTCCAGGCATGAGTTGGG + Intergenic
1096396255 12:51269167-51269189 GAGGCTTCCAGGACTGGTCTGGG + Intronic
1096807949 12:54151727-54151749 CAGGGCTCCAAGACTGAGGTGGG - Intergenic
1096875537 12:54627459-54627481 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1096960291 12:55570257-55570279 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1097302799 12:58036038-58036060 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1097329651 12:58318900-58318922 TAGGCGTCCAGGCCTGTGATGGG + Intergenic
1097368070 12:58742156-58742178 TAGGCCTCCGGGTCTGTGATGGG - Intronic
1097401687 12:59135038-59135060 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1097445590 12:59667795-59667817 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1097501583 12:60410205-60410227 TAGGCCTCCAGGCCTATGATGGG + Intergenic
1097554022 12:61115314-61115336 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1097571303 12:61335378-61335400 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1097575629 12:61389258-61389280 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1097618028 12:61907228-61907250 CAGGCCTCCAGTCCTGTGATGGG - Intronic
1097654734 12:62344964-62344986 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1097955841 12:65484364-65484386 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1098163934 12:67673726-67673748 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1098253149 12:68589866-68589888 TAGGCCTCTGGGACTGTGATGGG - Intergenic
1098578506 12:72071241-72071263 TAGACCTCCAGGCCTGTGATGGG + Intronic
1098649958 12:72952433-72952455 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
1098672454 12:73248276-73248298 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1098741615 12:74179444-74179466 CAGGCCTCCAGGCTTGTGATGGG + Intergenic
1098743207 12:74200831-74200853 TAGGCCTCCAGGCCTGTTATGGG + Intergenic
1098774847 12:74600097-74600119 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1098778566 12:74654242-74654264 TAGGGCTCCAGGCCTGTGATGGG + Intergenic
1098836769 12:75433118-75433140 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1099096366 12:78379281-78379303 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1099105112 12:78486942-78486964 TAGGCTTCCAGGTCTGTGATTGG + Intergenic
1099214552 12:79838511-79838533 CAGGCCTCCAGGCCTGTGATGGG - Intronic
1099229349 12:80003926-80003948 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1099407413 12:82281474-82281496 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1099536775 12:83855489-83855511 TAGGTCTCCAGGACTGTGATAGG - Intergenic
1099635161 12:85203985-85204007 TAGGCCTTCAGGCCTGTGATGGG - Intronic
1099663528 12:85596797-85596819 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1099675440 12:85755394-85755416 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1099800525 12:87451549-87451571 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1099838438 12:87937048-87937070 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1099932607 12:89091445-89091467 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1100038420 12:90281640-90281662 TAGTCCTCCAGGCCTGTGATTGG - Intergenic
1100361441 12:93883507-93883529 CAGACCTCAAGGACTGAGAAAGG + Intronic
1100747531 12:97661985-97662007 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
1101033881 12:100685812-100685834 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1101222812 12:102658278-102658300 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1101258013 12:102998430-102998452 TAGGCCTCCAGGTTTGTGATGGG + Intergenic
1101848708 12:108385299-108385321 GAGGAATGCAGGACTCAGATTGG - Intergenic
1102668904 12:114600736-114600758 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1103223553 12:119267176-119267198 TAGGCCTCCAGGCCTGTGACGGG - Intergenic
1103264537 12:119617969-119617991 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1103588388 12:121973055-121973077 TAGGCCTCCAGGACTGTGATGGG - Intronic
1104172145 12:126292206-126292228 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1104210531 12:126684183-126684205 TAGGCCTCCAGGCCTATGATGGG + Intergenic
1104240579 12:126985054-126985076 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1104830050 12:131744086-131744108 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1104956218 12:132467058-132467080 CAGGCCTCAAGGACTGAGGCCGG + Intergenic
1105227301 13:18448093-18448115 TAGGCCTCCTGGTCTGTGATGGG - Intergenic
1105530209 13:21212299-21212321 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1105650575 13:22372486-22372508 TAGGCCTCCAGGCCTGTTATGGG + Intergenic
1105928084 13:25026029-25026051 GAAGCCTCCAGAACTGAAATTGG + Intergenic
1105942804 13:25165052-25165074 GAAGCCTCCAGAACTGAAATTGG - Intronic
1106106565 13:26738430-26738452 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
1106678266 13:31984510-31984532 TAGGCTTCCAGGTCTGTGATTGG - Intergenic
1106718733 13:32418141-32418163 TAGGTCTCCAGGCCTGTGATGGG - Intronic
1106734747 13:32577818-32577840 TTGGCCTCCAGGCCTGTGATGGG - Intergenic
1107039494 13:35933744-35933766 TAGGCCTCCAGGCTTGTGATGGG + Intronic
1107641312 13:42446731-42446753 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
1107961892 13:45566412-45566434 TAGGCCTTCAGGCCTGTGATGGG - Intronic
1108175725 13:47790920-47790942 TGGGCCTCCAGGCCTGCGATGGG - Intergenic
1108512553 13:51169557-51169579 TGGGCCTCCAGGCCTGGGATGGG - Intergenic
1108596796 13:51956333-51956355 CAGGCCTCCAGGACACAGCTAGG + Intronic
1108770926 13:53699839-53699861 TAGGCCTCCAGGTCTGTGAAGGG - Intergenic
1108790635 13:53966099-53966121 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1108933929 13:55864269-55864291 TGGCCCTCCAGGACTGTGATGGG - Intergenic
1109276214 13:60306781-60306803 TAAGCCTCCAGAACTGTGATGGG + Intergenic
1109346989 13:61126092-61126114 AGGGCCTCCAGGCCTGCGATGGG + Intergenic
1109390144 13:61682502-61682524 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
1109404394 13:61878489-61878511 TAGGCCTCCAGGCATGTGATAGG - Intergenic
1109485290 13:63010332-63010354 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1109491020 13:63100499-63100521 TAGGCCTCTGGGACTGTGATAGG - Intergenic
1109655700 13:65387908-65387930 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
1109863049 13:68225190-68225212 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1109876135 13:68406114-68406136 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
1109883458 13:68511939-68511961 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1109962079 13:69644594-69644616 AAGGCCTCCAGGCCTATGATGGG - Intergenic
1110033812 13:70653955-70653977 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
1110208679 13:72947392-72947414 TAGGGCTCCAGGCCTGTGATTGG + Intronic
1110250719 13:73377534-73377556 TAGGCCTCCAGGCCTGAGATGGG + Intergenic
1110280571 13:73688876-73688898 CAGACCTCCAGGTCAGAGATAGG + Exonic
1110395877 13:75029161-75029183 TAGACCTCCAGGACTGTAATGGG - Intergenic
1110492338 13:76124401-76124423 TAGGCCTCTGGGCCTGAGATAGG - Intergenic
1110559806 13:76898611-76898633 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
1110793682 13:79612814-79612836 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1110847371 13:80205738-80205760 CTGGCCTCCAGGACTGTGAAAGG - Intergenic
1110902287 13:80837843-80837865 TAGGCTTCCAGGTCTGTGATGGG + Intergenic
1110970820 13:81758688-81758710 TAGGCCTCCAGGCCTTTGATGGG + Intergenic
1111036199 13:82677466-82677488 TAGGCCTCTAGGCCTGCGATGGG + Intergenic
1111065711 13:83089030-83089052 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1111072521 13:83187587-83187609 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1111207758 13:85035095-85035117 TAGGCCTCCAGGCCAGTGATGGG - Intergenic
1111334626 13:86803417-86803439 TAGGCCTCTAGGACTGTGATGGG + Intergenic
1111442902 13:88304242-88304264 TAGGCCTCCAGTTCTGTGATGGG - Intergenic
1111539371 13:89650751-89650773 TAGGCCTCCGGGTCTGTGATGGG + Intergenic
1111594083 13:90389243-90389265 TAGGCCTCCAGGCATGTGATGGG - Intergenic
1111601671 13:90482062-90482084 TAGGCCTCCATGTCTGTGATGGG + Intergenic
1112512199 13:100019994-100020016 TAGGCCTCCAGGCCTGTGAAGGG - Intergenic
1112568268 13:100569564-100569586 TAGGTCTCCAGGCCTGTGATGGG + Intronic
1112789576 13:102988107-102988129 TAGGCCTCCAGGCCTGTGACGGG + Intergenic
1112790334 13:102995618-102995640 CAGGCCTCCAGGCCTGTAATGGG + Intergenic
1112812378 13:103233818-103233840 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1112826635 13:103398965-103398987 TCGGCCTCCAGGCCTGTGATGGG + Intergenic
1112857829 13:103792581-103792603 TGGGCCTCCAGGCCTGTGATTGG + Intergenic
1112881282 13:104109283-104109305 GAGGCCTACAGGCCTGTGATGGG - Intergenic
1112887571 13:104193331-104193353 TAGGCATCCAGGACTGTGATGGG - Intergenic
1113167042 13:107453561-107453583 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1113450798 13:110407995-110408017 GAGGCGTCCAGGAGGGAGGTAGG + Intronic
1113644233 13:111981121-111981143 GCGGCCTCCAGAGCTGAGAGGGG - Intergenic
1113842026 13:113365796-113365818 GAGGCTTCCAGGCCTGGGGTTGG - Intergenic
1114380472 14:22198444-22198466 GAGGCCTTCAGGCCTGTGATGGG - Intergenic
1114383471 14:22232663-22232685 TAGGCCTCAAGGCCTGTGATGGG + Intergenic
1114504556 14:23199304-23199326 GAGGCTTCCAGGTCACAGATAGG + Intronic
1114780497 14:25533261-25533283 TAGGCCTCCAGGCCTGTGACAGG + Intergenic
1114795725 14:25712738-25712760 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1114839721 14:26249024-26249046 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
1114921933 14:27343190-27343212 TAGGCCTCCAGGCATGTGATGGG - Intergenic
1115199161 14:30834594-30834616 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1115298504 14:31857344-31857366 TAGGCCTCCAGACCTGTGATGGG + Intronic
1115481778 14:33867888-33867910 TAGACCTCCAGGCCTGTGATGGG + Intergenic
1115943063 14:38629617-38629639 TAGGCCTCCAGGCCAGTGATAGG + Intergenic
1116095258 14:40359491-40359513 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1116213060 14:41972485-41972507 TAGGCCTCCAGGCCTGTTATGGG + Intergenic
1116263515 14:42660639-42660661 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1116275199 14:42824177-42824199 TAGGCCTCCAGGCCTATGATTGG - Intergenic
1116281596 14:42915051-42915073 AAGGCCTCCAGGTCTGTAATGGG + Intergenic
1116387345 14:44348093-44348115 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1116415569 14:44673004-44673026 TAGGCCTCCAGGCCAGTGATGGG + Intergenic
1116485469 14:45443802-45443824 TAGGCCTCCAGGCCTGTGATCGG - Intergenic
1116625138 14:47254115-47254137 TAGCCCTCCAGGCCTGTGATGGG + Intronic
1116742620 14:48776331-48776353 TAGGCCTCCAGGTTTGTGATGGG - Intergenic
1116762050 14:49026879-49026901 TTGGCCTCCAGGCCTGTGATGGG - Intergenic
1116854142 14:49937307-49937329 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1116931391 14:50694484-50694506 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1117084157 14:52181552-52181574 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1117234290 14:53754857-53754879 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1117396224 14:55312830-55312852 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1117854232 14:60010477-60010499 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1117907465 14:60605498-60605520 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1117908271 14:60612258-60612280 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1118060867 14:62136066-62136088 TAGGCCTCCAGACCTGTGATGGG + Intergenic
1118957058 14:70491840-70491862 TAGGCCTCCAGGCCTGTGACGGG + Intergenic
1119216399 14:72872244-72872266 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1119305828 14:73607459-73607481 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1119450189 14:74702548-74702570 TAGGCCTCCAGGTCTGTGATGGG + Intronic
1119862594 14:77947499-77947521 TAGGCCTCCAGGTCTGTGACGGG - Intergenic
1119963067 14:78881899-78881921 TAGGCCTCCAGGTTTGTGATGGG - Intronic
1120104005 14:80473892-80473914 TAGGACTCCAGGCCTGTGATGGG + Intergenic
1120270614 14:82309371-82309393 TAGGCCGCCAGGCCTGTGATGGG - Intergenic
1120326522 14:83036667-83036689 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1120377670 14:83730125-83730147 TAGGCCTCCAGGTCTGTGATTGG + Intergenic
1120457738 14:84754308-84754330 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1120659073 14:87230947-87230969 TAGGCCACCAGGTCTGTGATGGG + Intergenic
1120799826 14:88675550-88675572 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1120808900 14:88782519-88782541 GAGGCCTCCGAGCCTGTGATGGG - Intronic
1120921114 14:89756063-89756085 TAGGCCTCCAGGACATTGATGGG + Intergenic
1120956695 14:90089679-90089701 TAGGCCTCCGGGCCTGTGATGGG - Intronic
1121128781 14:91427043-91427065 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1121130181 14:91439007-91439029 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1121237986 14:92406780-92406802 TAGGCCTCCAGGCTTGTGATGGG + Intronic
1121243554 14:92447116-92447138 GAGGTCTGCAGGACAGAGGTGGG - Intronic
1121499011 14:94418937-94418959 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1121707711 14:96011340-96011362 TAGGCCTCAAGGCCTGTGATGGG + Intergenic
1122038839 14:98967607-98967629 GATGCCAGCAGCACTGAGATTGG - Intergenic
1122490363 14:102111228-102111250 TAGGCCTCCAAGCCTGTGATGGG - Intronic
1122765559 14:104066953-104066975 TAGTCCTCCAGGCCTGTGATGGG + Intergenic
1122768706 14:104087503-104087525 AAGGCCTGCAGGACAAAGATGGG + Intronic
1122801726 14:104234122-104234144 AAAGCCTCCAGGCCTGTGATGGG - Intergenic
1122831851 14:104402041-104402063 TAGGCCTCCACGCCTGAGATCGG - Intergenic
1123128086 14:105964172-105964194 TAGGCCTCCAGGCCTGTGATTGG - Intergenic
1123138207 14:106050253-106050275 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1123408609 15:20040328-20040350 TAGGCCTCCAGGCCTGTGATTGG - Intergenic
1123517940 15:21047038-21047060 TAGGCCTCCAGGCCTGTGATTGG - Intergenic
1123795559 15:23766935-23766957 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1124136172 15:27038107-27038129 GTGGCCAACCGGACTGAGATGGG - Intronic
1124444928 15:29722242-29722264 TAGGCCTCCAGGCTTGTGATGGG - Intronic
1124509118 15:30307078-30307100 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1124691441 15:31826501-31826523 TTGGCCTCCAGGCCTGTGATAGG + Intronic
1124734441 15:32231584-32231606 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1125011707 15:34883936-34883958 GAGGCATACAGGACTTAGAATGG + Intronic
1125066140 15:35487631-35487653 TCGGCCTCCAGGCCTGTGATGGG + Intronic
1125251753 15:37713211-37713233 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
1125274018 15:37971413-37971435 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1125472136 15:40014616-40014638 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1126203799 15:46019699-46019721 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1126366910 15:47903581-47903603 TAGGCCTCTAGGCCTGTGATAGG + Intergenic
1126514965 15:49524192-49524214 TAGGCCTCCAAGCCTGTGATGGG - Intronic
1126647962 15:50894143-50894165 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1126736810 15:51738348-51738370 GAGGCAGCCAGGACTTAAATTGG - Intronic
1126825112 15:52540644-52540666 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1127265308 15:57356058-57356080 GAGGACTCCAGGGCTGGGAAAGG + Intergenic
1127582100 15:60347865-60347887 GAAGCCTCCAGGAGTGTGGTCGG + Intronic
1127791032 15:62398927-62398949 TAGGCCTCCGGGCCTGAGATGGG - Intronic
1129168823 15:73795624-73795646 GTGGCCTGCAGGAATGAGAGAGG + Intergenic
1129549176 15:76429904-76429926 TAGGCCTCCAGGTCTGTGATGGG - Intronic
1129715338 15:77845219-77845241 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
1129738423 15:77978253-77978275 CTGGCCTCCAGGTCTGAGCTGGG + Intergenic
1129847650 15:78775356-78775378 CTGGCCTCCAGGTCTGAGCTGGG - Intronic
1129930257 15:79404643-79404665 GAGGCCTAAAGGAGTAAGATTGG - Intronic
1129944188 15:79524790-79524812 GAGGCCACCAGGCCTGGGCTTGG + Intergenic
1130062731 15:80581244-80581266 GAGTCTTGCTGGACTGAGATGGG - Exonic
1130244018 15:82226527-82226549 GAGGTCTCCCTAACTGAGATGGG + Intronic
1130600716 15:85271417-85271439 CTGGCCTCCAGGTCTGAGCTGGG - Intergenic
1130988176 15:88858304-88858326 GAATCCTCCAGAGCTGAGATTGG + Exonic
1131659476 15:94498702-94498724 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
1131752669 15:95526369-95526391 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1131980141 15:97986944-97986966 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1132122757 15:99192331-99192353 TAAGCCTCCAGGCCTGTGATGGG - Intronic
1132958993 16:2611938-2611960 GAGGCCTCCATGGCTGACAAAGG + Intergenic
1132972052 16:2693913-2693935 GAGGCCTCCATGGCTGACAAAGG + Intronic
1133327173 16:4948889-4948911 GAGGCCTCAGGCACTGAGCTGGG + Intronic
1136642340 16:31577570-31577592 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1136662855 16:31780510-31780532 TGGGCCTCCAGGCCTGTGATGGG - Intronic
1137446191 16:48534051-48534073 GAGCCCTCCAGAACAGACATTGG + Intergenic
1137597496 16:49734509-49734531 GAGGCCTCCAGGGCTGGGGAGGG + Intronic
1137638512 16:50008548-50008570 TGGGCCTCCAGGCCTCAGATGGG - Intergenic
1138024802 16:53513801-53513823 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1138198523 16:55071971-55071993 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1138211640 16:55167954-55167976 CTGGCCTCCAGGACTGTGAGAGG + Intergenic
1138349857 16:56340685-56340707 GAGACCACCAGGACGGAGACGGG - Intronic
1138997601 16:62474030-62474052 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1140704405 16:77613296-77613318 CAGGCCTCCAGGAATGAGTCAGG - Intergenic
1141037862 16:80643829-80643851 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1141169250 16:81680782-81680804 GAAGCCTCCAGGCCAGAGAGTGG + Intronic
1141317785 16:82978423-82978445 AAGGCCTCCAGGCCTGCAATGGG - Intronic
1141814394 16:86399909-86399931 GAGGCTTCCAGGGCTGAGAATGG - Intergenic
1141975204 16:87511064-87511086 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
1142435546 16:90054717-90054739 TAAGCCTCCAGGCCTGTGATAGG - Intergenic
1142625238 17:1187535-1187557 GAAGCCCCCAGGAGTGACATGGG + Intronic
1142840267 17:2623096-2623118 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1143210894 17:5186457-5186479 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1143456016 17:7068248-7068270 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1143626140 17:8111145-8111167 GAGGCTTTGAGGCCTGAGATGGG - Intronic
1143935762 17:10482286-10482308 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1144153974 17:12480120-12480142 GAGGCATCCAGGAGTGAGGTTGG + Intergenic
1144464456 17:15485929-15485951 GAGCACCCCAGGACTCAGATTGG - Intronic
1144790418 17:17855297-17855319 GGGGCCTCCAGGTCTGAGGAGGG + Intronic
1145022532 17:19443045-19443067 TAGGCCTCCATGCCTGTGATGGG - Intergenic
1145378209 17:22371190-22371212 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
1145772194 17:27501493-27501515 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1146391747 17:32429522-32429544 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
1146451987 17:32981812-32981834 TAGGCCTCCTGGCCTGTGATGGG + Intronic
1147704991 17:42420318-42420340 GAGGTCTGCAGGCCTGAGAAGGG - Intronic
1147834457 17:43320002-43320024 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1148640713 17:49185268-49185290 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1148854904 17:50573345-50573367 GAGGCCTCCAGCACTGCTCTGGG + Intronic
1149079064 17:52632446-52632468 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1149113488 17:53063028-53063050 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1149163958 17:53727238-53727260 GAGGCCTCTGGGCCTGTGATGGG + Intergenic
1149341085 17:55687190-55687212 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1149366674 17:55952332-55952354 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
1150203076 17:63377153-63377175 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1150941500 17:69698570-69698592 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1151135790 17:71944882-71944904 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1151501036 17:74488953-74488975 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1151857859 17:76736250-76736272 GAGGACTCCTGGACCGAGACCGG + Exonic
1152258737 17:79255169-79255191 GCTGCCTCCAGGACAGAGAATGG + Intronic
1153011988 18:547569-547591 TGGGCCTCCAGGACTGTGATGGG + Intergenic
1153421960 18:4916848-4916870 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1153426917 18:4975124-4975146 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1153539120 18:6135250-6135272 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1153556859 18:6323923-6323945 TTGGCCTCCAGGCCTGTGATGGG - Intronic
1154526078 18:15291382-15291404 TAGGCCTCCTGGTCTGTGATGGG + Intergenic
1155544804 18:26903908-26903930 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
1155632176 18:27906427-27906449 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1155748542 18:29391206-29391228 TAGGCCTCTAGGCCTGTGATTGG - Intergenic
1155773085 18:29724876-29724898 TAGGCCTCCAGACCTGTGATGGG + Intergenic
1156052397 18:32952578-32952600 TAGGCCTCCAGGCCTGTGACGGG + Intronic
1156065613 18:33139881-33139903 TAGGTCTCCAGGCCTGTGATGGG - Intronic
1156207941 18:34906296-34906318 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1156607258 18:38680588-38680610 TAGGCATCTAGGCCTGAGATGGG + Intergenic
1156914411 18:42448173-42448195 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1157077216 18:44479272-44479294 CAGGTCTCCAGGCCTGTGATGGG - Intergenic
1157416873 18:47510776-47510798 GTGGCCTAGAGGACTGAGAGTGG - Intergenic
1157685335 18:49638771-49638793 GAGGCCTCGAGTGCTGAGATGGG + Intergenic
1158061529 18:53348880-53348902 GAGGCATCCAGGCCTGTCATGGG + Intronic
1158101493 18:53834702-53834724 GAGGCCTCCTGAACTGGGATGGG - Intergenic
1158833225 18:61303250-61303272 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1159288811 18:66390559-66390581 TAGGCCTCCAGGCCTGTAATAGG - Intergenic
1159357720 18:67358648-67358670 TAGGCCCCCAGGGCTGTGATGGG - Intergenic
1159410816 18:68072871-68072893 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
1159651692 18:70986096-70986118 TAGGCCTCCAGGCCTGTTATGGG - Intergenic
1159652546 18:70995499-70995521 CAGGCCTCCATGCCTGTGATGGG - Intergenic
1159717927 18:71849057-71849079 TAGGCCTCCAGGCCTGTGTTGGG - Intergenic
1159962461 18:74566206-74566228 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1159989791 18:74891168-74891190 GAAGCCTGCAAGAGTGAGATTGG + Intronic
1160599362 18:80001016-80001038 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1160845243 19:1163412-1163434 GTGGCCTCCAGGACAGGGACAGG + Intronic
1161243918 19:3238452-3238474 CTGGCCTCCAGGACTGGGAGAGG - Intronic
1161986211 19:7655962-7655984 GAGGTGTCCAGGGCTGGGATAGG + Intergenic
1162296331 19:9816160-9816182 TGGGCTTCCAGGCCTGAGATGGG + Intronic
1163292295 19:16386791-16386813 GAGGCCACAAGAACTGAGCTGGG + Intronic
1163539658 19:17900315-17900337 TAGGCCTCCAGCCCTGTGATGGG - Intergenic
1163612918 19:18310300-18310322 GAGGCTTCCAGAAGTGAGGTGGG - Intronic
1163677707 19:18663572-18663594 GAGGCCACCAGGACAGAGCAGGG + Intronic
1164447357 19:28329582-28329604 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
1165136706 19:33674207-33674229 GAGGCCTCCTGGACAGAGGAGGG + Intronic
1165182557 19:33985209-33985231 GAGGCGTCCAGTCCTGAGATGGG + Intergenic
1165897881 19:39154463-39154485 GTTGCCTCCAGGGCTGAGCTGGG + Intronic
1167463096 19:49636569-49636591 GGAGCCTCCCAGACTGAGATGGG + Intronic
1168496169 19:56853640-56853662 TATGCCTCCAGGCCTGTGATGGG - Intergenic
1168623771 19:57900472-57900494 GAGGCCTGCAGCATTAAGATGGG - Intronic
1168655419 19:58123845-58123867 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
925527060 2:4814337-4814359 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
925794989 2:7531407-7531429 CAGGCCTTCAGGCCTGTGATGGG + Intergenic
925805199 2:7641481-7641503 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
925924460 2:8660165-8660187 GAGGCTTCAAGGACAGAGAAGGG + Intergenic
926391914 2:12402634-12402656 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
926468033 2:13215319-13215341 TAGGCCTCCAGGCCTGTGTTGGG + Intergenic
926508087 2:13740873-13740895 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
926734660 2:16063664-16063686 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
926768972 2:16351290-16351312 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
926840121 2:17070919-17070941 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
926840880 2:17079422-17079444 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
926929657 2:18024010-18024032 TTGGCCTCCAGGCCTGTGATGGG + Intronic
927007553 2:18866272-18866294 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
927341938 2:21992578-21992600 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
927438258 2:23088885-23088907 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
927605573 2:24483717-24483739 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
927869214 2:26613153-26613175 GAGGCCTCCAGGCATAAGCTGGG - Intronic
928465536 2:31519468-31519490 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
928594229 2:32845356-32845378 TAGGCCTCCGGGCCTGTGATGGG - Intergenic
928804399 2:35132790-35132812 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
928927403 2:36593693-36593715 TGGGCCTCCAGGCCTGTGATGGG + Intronic
929081557 2:38127425-38127447 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
929194516 2:39171584-39171606 TAGGCCACCAGGGCTGAGAGAGG + Intergenic
929211298 2:39359906-39359928 TAAGCCTCCAGGGCTGTGATGGG + Intronic
929358071 2:41050572-41050594 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
929541246 2:42824117-42824139 GAGGCCTTCAGGACTAAAACTGG - Intergenic
929917066 2:46144937-46144959 GAGAGCCCCTGGACTGAGATGGG + Intronic
930480560 2:51943639-51943661 TAGGCCTCCAGGCCTGTGAATGG - Intergenic
930523462 2:52497409-52497431 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
930544092 2:52745490-52745512 TAGGCCTCAAGGCCTGTGATGGG - Intergenic
930960171 2:57251705-57251727 CAGGCCTCCAGGCCTGTGATGGG + Intergenic
931494153 2:62783735-62783757 CAGGCCTCCTGGCCTGTGATGGG + Intronic
931529611 2:63199368-63199390 TAGGCCTCCAGGCTTGTGATAGG - Intronic
931949882 2:67350346-67350368 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
931983717 2:67721703-67721725 TTGGCCTCCAGGCCTGTGATGGG - Intergenic
932423196 2:71613299-71613321 GAGCCATCCAGGCCTGAGAGGGG - Intronic
932897625 2:75657351-75657373 GACCCCTCCAGGAAGGAGATTGG - Exonic
932923270 2:75941750-75941772 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
932956439 2:76356974-76356996 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
933047551 2:77558032-77558054 TAGGCCTCCAGGCCTGTGATGGG - Intronic
933085069 2:78045883-78045905 TAGGCCTCCAGGTCTGTTATGGG - Intergenic
933209781 2:79552868-79552890 TAGGCCTCCAGGCCTGTAATGGG + Intronic
933439839 2:82298045-82298067 TAGGCCTCCAGGTCTATGATGGG + Intergenic
933539420 2:83619359-83619381 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
933578144 2:84093044-84093066 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
933790717 2:85881929-85881951 TGGGCCTCCAGGCCTGTGATGGG - Intronic
933798749 2:85942776-85942798 TAGGCCTCCAGACCTGTGATGGG + Intergenic
934017092 2:87899512-87899534 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
934054948 2:88243793-88243815 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
934106958 2:88703645-88703667 TAGGCCTCCAGGTGTGTGATGGG + Intronic
934112969 2:88759500-88759522 CAGGCCTCCCGGCCTGTGATGGG - Intergenic
934700803 2:96438732-96438754 TAGGCCTCCAGACCTGTGATGGG - Intergenic
935300567 2:101690344-101690366 GAGACCAGCAGGACTGACATGGG - Intergenic
935384318 2:102485135-102485157 GAGGCCTGAAGGACCGAGAAGGG - Intronic
935718003 2:105955376-105955398 GAGGCCCCCGGGAGTGACATGGG + Intergenic
936169333 2:110154998-110155020 TAGGCCTCCTGGCCTGTGATGGG - Intronic
937008885 2:118543922-118543944 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
937380700 2:121374068-121374090 TAGGCCTCCAGGTCTGTGATGGG - Intronic
937465306 2:122127219-122127241 TAAGCCTCCAGGCCTGTGATAGG - Intergenic
937561039 2:123223990-123224012 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
937680065 2:124634008-124634030 CAGGCCTCCAGGCTTGTGATGGG + Intronic
937863831 2:126733196-126733218 GAGGCCAGCAGGACAGACATTGG + Intergenic
937881311 2:126866824-126866846 TGGGCCTCCAGGCCTGTGATAGG + Intergenic
937935199 2:127238588-127238610 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
938698119 2:133853056-133853078 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
938868901 2:135453262-135453284 TGGGCCTCCAGGCCTGTGATGGG + Intronic
939037354 2:137148989-137149011 CAGACCTCCAGGCCTGTGATGGG - Intronic
939137673 2:138315852-138315874 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
939224970 2:139353636-139353658 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
939417812 2:141924036-141924058 CAGGCCTCCAGACTTGAGATTGG - Intronic
939578049 2:143919417-143919439 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
939667070 2:144965339-144965361 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
939830376 2:147064188-147064210 TAGGCCTCCATGCCTGTGATGGG - Intergenic
939852883 2:147321228-147321250 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
940430914 2:153588607-153588629 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
940484053 2:154275311-154275333 TAGGCCTCCAGGCCTGTGATGGG - Intronic
940505300 2:154546441-154546463 TAGGCCTCCAGTTCTGTGATGGG - Intergenic
940533151 2:154905124-154905146 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
940543028 2:155046065-155046087 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
940691293 2:156923927-156923949 TAGGTCTCCAGGCCTGTGATAGG - Intergenic
940826298 2:158416244-158416266 TAGGCCTCCAGGGCTGTGATGGG + Intronic
941123690 2:161561429-161561451 TAGGCCTCCAGGCCTTTGATGGG - Intronic
941227279 2:162865345-162865367 TAGGCCTCCAGGCCTTTGATGGG + Intergenic
941307822 2:163892530-163892552 TGGGCCTCCAGGCCTGTGATAGG + Intergenic
941335724 2:164241051-164241073 TAGGCTTCCAGGTCTGTGATGGG + Intergenic
941346198 2:164372347-164372369 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
941468955 2:165861048-165861070 TAGGCTTCCAGGCCTGTGATGGG + Intronic
941490579 2:166138338-166138360 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
941977691 2:171423918-171423940 TAGGCCTCTAGGCCTGTGATGGG - Intronic
942203292 2:173593321-173593343 TAGTCCTCCAGGCCTGTGATGGG + Intergenic
942283341 2:174389699-174389721 TAGGCCTCCAGGCCTATGATGGG - Intronic
942387779 2:175460569-175460591 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
942724799 2:178994517-178994539 TAGGCCTCCAGGCCTGTGATGGG + Intronic
942908023 2:181206771-181206793 TAGGCCTCCAGGTCTGTAATGGG + Intergenic
942950038 2:181712036-181712058 TAGGCTTCCAGGTCTGTGATGGG - Intergenic
943006589 2:182393401-182393423 TAGGCCTCTAGGCCTGTGATGGG + Intronic
943237991 2:185347521-185347543 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
943315842 2:186386271-186386293 TAGGCCTCTGGGACTGTGATGGG + Intergenic
943372062 2:187028103-187028125 TAGGCTTCCAGGCCTGGGATGGG - Intergenic
943406443 2:187493401-187493423 TAAGCCTCCAGGCCTGTGATGGG + Intronic
943423284 2:187697555-187697577 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
943511201 2:188830102-188830124 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
943543324 2:189244079-189244101 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
943620272 2:190140697-190140719 TAGGCCTCCAGGCCTGTGATGGG + Intronic
943880725 2:193140716-193140738 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
943944679 2:194044418-194044440 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
944010193 2:194965347-194965369 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
944250160 2:197573715-197573737 TAGGCCTCCAGGCTTGTGATGGG - Intronic
944303899 2:198157478-198157500 TAAGCCTCCAGGTCTGTGATGGG - Intronic
944920978 2:204412942-204412964 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
945073593 2:206015324-206015346 TAGGCCTCCAGGCCTATGATGGG - Intronic
945089883 2:206168891-206168913 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
945166686 2:206954069-206954091 TAGGCCTCCAGGCCTGTGATGGG + Intronic
945328797 2:208515320-208515342 TAGGCCTCCAAGCCTGTGATGGG + Intronic
945360072 2:208886492-208886514 GAGGCCTCCAGGCCTATGATGGG - Intergenic
945534020 2:210989588-210989610 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
945618646 2:212106687-212106709 TAGGCCTCCAGGCCTGTGATGGG - Intronic
945900631 2:215533898-215533920 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
946574298 2:221057415-221057437 GGGGCCTCCTGGCCTGTGATGGG + Intergenic
946732292 2:222721037-222721059 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
946898170 2:224345708-224345730 TAGGCGTCCAGGCCTGTGATGGG + Intergenic
946939692 2:224758088-224758110 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
946988573 2:225302570-225302592 TAGGCCCCCAGGCCTGTGATAGG - Intergenic
946990063 2:225318606-225318628 CAGGCCTCCAAGCCTGTGATGGG - Intergenic
947048781 2:226018854-226018876 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
947328042 2:228999492-228999514 TAGGCCTGCAGGCCTGTGATGGG - Intronic
947396640 2:229693954-229693976 TAGGCCTCCAGGCCTGTGATAGG - Intronic
947488235 2:230571713-230571735 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
947893478 2:233646259-233646281 TAGGCCTCCAGGCCTGTGATGGG + Intronic
947903061 2:233738904-233738926 TAGGCCTCCAGGCCTGTGATGGG - Intronic
947904478 2:233750569-233750591 TAGGCCTCCAGGCCTGTGATGGG - Intronic
948296681 2:236865709-236865731 TAGGCCTCTAGGCCTGCGATGGG + Intergenic
948773140 2:240262685-240262707 TAGACCTCCAGGCCTGTGATGGG - Intergenic
948837657 2:240633864-240633886 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1170643919 20:18179627-18179649 TAGGCTTCCAGGTCTGTGATGGG + Intronic
1170741773 20:19064945-19064967 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1170750393 20:19139791-19139813 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1171001926 20:21423543-21423565 TAGACCTCCAGGCCTGTGATGGG + Intergenic
1171399634 20:24864597-24864619 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1172812035 20:37654974-37654996 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1173711002 20:45155760-45155782 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1174531469 20:51217827-51217849 CAGGCCTCCAAGCCTGTGATGGG + Intergenic
1174548545 20:51344565-51344587 TGGGCCTCCAGGACTGGGAGAGG + Intergenic
1174705051 20:52646900-52646922 TTTGCCTCCAGGTCTGAGATGGG - Intergenic
1175195423 20:57239935-57239957 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1175705369 20:61172659-61172681 GAAGCCTCCAGCAATGGGATAGG - Intergenic
1175785853 20:61711460-61711482 GTGGCCTCCAGGATTGGGAAAGG - Intronic
1176124273 20:63468536-63468558 GAGTTCTCCAGGACTGTGAGGGG + Intronic
1176771344 21:13077106-13077128 TAGGCCTCCTGGTCTGTGATGGG - Intergenic
1177067905 21:16463858-16463880 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1177130392 21:17248233-17248255 TAGGCCTCTGGGACTGTGATGGG - Intergenic
1177236171 21:18392078-18392100 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1177285207 21:19040556-19040578 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1177478114 21:21650875-21650897 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1177528994 21:22336708-22336730 TAGTCCTCCAGGCCTGTGATGGG - Intergenic
1177839237 21:26218056-26218078 TAGGCCTGCAGGCCTGTGATGGG - Intergenic
1178011376 21:28290416-28290438 TAGGCCTCCAGGCCTATGATGGG + Intergenic
1178127071 21:29527041-29527063 TAGGCCTCCAGGCCTGTGATAGG + Intronic
1178143921 21:29716901-29716923 TAGGCCTCCAGGCCTATGATGGG - Intronic
1178173943 21:30075685-30075707 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1178422162 21:32451599-32451621 GTGGCCTCCAGAACTGTGAGAGG - Intronic
1179936640 21:44610287-44610309 CAGGCCTCCAGGCCTCTGATGGG - Intronic
1180153395 21:45964788-45964810 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1180163299 21:46007429-46007451 GGGGCCTCCAGGCCTGAGGCAGG - Intergenic
1180251344 21:46592240-46592262 CAGGCTTCCAGGACTGTGATAGG - Intergenic
1180836000 22:18929744-18929766 GAGGCCTCCAGCCCTGGGAACGG - Intronic
1180847920 22:18994483-18994505 GACGTCTCCAGGTGTGAGATGGG + Intergenic
1181448687 22:23000983-23001005 TAGGCCTCCAGGCATGTGATGGG + Intergenic
1182945261 22:34316079-34316101 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1183197611 22:36364284-36364306 GAGGGCTCCAAGGCAGAGATCGG + Intronic
1183356063 22:37360247-37360269 GAGGCAGCCAGGCCTGGGATGGG + Intergenic
1183566617 22:38620038-38620060 GAGGCCTCCAGGTCTCCCATGGG - Intronic
1183724800 22:39582589-39582611 GAGGGCACCAAGACTGAGAGTGG + Intronic
1183945784 22:41325019-41325041 GAGGCCCCCAGGACTGGAAAAGG - Intronic
1184149933 22:42631931-42631953 GGGGCAGCCAGGACTGAGGTGGG + Intronic
1184311887 22:43651165-43651187 TAGACCTCCAGGCCTGTGATGGG - Intronic
1184713303 22:46265794-46265816 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1185178852 22:49347844-49347866 GATGCCTCCAGGACCCAGAGAGG - Intergenic
1203286092 22_KI270734v1_random:155043-155065 GAGGCCTCCAGCCCTGGGAACGG - Intergenic
949156286 3:830618-830640 TAGGCCTCCGGGCCTGTGATAGG + Intergenic
949230479 3:1744296-1744318 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
949693021 3:6662357-6662379 TAGGCCTCCATGCCTGTGATGGG + Intergenic
949770396 3:7571114-7571136 TAGGCCTCCAGTCCTGTGATGGG + Intronic
950146033 3:10650641-10650663 TAGGCCTCCAAGCCTGTGATAGG - Intronic
950412167 3:12846138-12846160 TAGGCCTCTAGGACTGTAATGGG - Intronic
950429338 3:12941833-12941855 GAGGCCCCCAGCAGTGAGACTGG - Exonic
950853156 3:16081855-16081877 TAGGCCTCCCGGCCTGTGATGGG + Intergenic
950963318 3:17128515-17128537 TAGGCCTCCATGCCTGTGATTGG - Intergenic
951058273 3:18173273-18173295 TAGGCTTCCAGGTCTGTGATGGG + Intronic
951093126 3:18598215-18598237 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
951358994 3:21702439-21702461 TGGGCCTCCAGGCCTGTGATGGG + Intronic
951446192 3:22782842-22782864 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
951756494 3:26096663-26096685 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
951865094 3:27299138-27299160 GAAACCTCCAGGCCTGTGATGGG - Intronic
952022431 3:29040057-29040079 TAGGCCACCAGGACTTTGATGGG - Intergenic
952029064 3:29119679-29119701 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
952141117 3:30480272-30480294 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
952198537 3:31101439-31101461 CAGGCCTCCAGGTGTGTGATGGG + Intergenic
952608769 3:35181818-35181840 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
952624925 3:35392409-35392431 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
952808023 3:37375485-37375507 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
952831454 3:37568341-37568363 TAGGCCTCCAGGCCTGTGATAGG + Intronic
952939749 3:38433302-38433324 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
953095024 3:39766609-39766631 TAGGCCTCCAGGCCAGTGATGGG + Intergenic
953111370 3:39943095-39943117 GAGGCACCCATGACTGAGACTGG + Intronic
953503715 3:43462736-43462758 TAGGCCTCCTGGCCTGTGATGGG - Intronic
953835485 3:46339319-46339341 TAGGCCTCCAGACCTGTGATGGG + Intergenic
953898539 3:46823539-46823561 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
954516886 3:51186600-51186622 TAGGCCTCTAGGCCTGTGATGGG - Intronic
955326522 3:58012867-58012889 CATGCCTCCAGCTCTGAGATAGG + Intronic
955407670 3:58635767-58635789 AAGGGCACCAGGACTGGGATGGG - Intronic
955869107 3:63417877-63417899 AAGGCCTCCGGGCCTGTGATGGG + Intronic
956169583 3:66422115-66422137 TAGGCCTCCAGGCCTGTGATGGG + Intronic
956185726 3:66560119-66560141 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
956347768 3:68299668-68299690 TAGGCCTCCAGGCCTGTAATGGG - Intronic
956474921 3:69609819-69609841 TAGACCTCCAGGCCTGTGATGGG - Intergenic
956503215 3:69910018-69910040 TGGGCCTCCAGGCCTGTGATGGG - Intronic
956558850 3:70551304-70551326 TAGGCCTCCAGACCTGTGATGGG + Intergenic
957131408 3:76226921-76226943 GAGGCCTCCTGGACTTTCATGGG - Intronic
957293384 3:78306388-78306410 TAGGCCTCCAGACCTGTGATGGG - Intergenic
957374273 3:79336281-79336303 TAGGCTTCCAGGCCTGTGATGGG - Intronic
957474460 3:80705495-80705517 TAGGCCTCCAGTCCTGTGATGGG + Intergenic
957495071 3:80982148-80982170 TAGGCCTCCAGGCCTTTGATGGG - Intergenic
957524089 3:81357959-81357981 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
957662797 3:83183519-83183541 TAGGCCTCCAGGCATGTGATGGG - Intergenic
957703958 3:83755799-83755821 CAGGCATCCAGGCCTGTGATGGG - Intergenic
957711090 3:83860231-83860253 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
958042557 3:88244528-88244550 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
958050339 3:88336035-88336057 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
958065902 3:88544789-88544811 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
958085032 3:88795726-88795748 CAGGCCTCCAGGCCTGTGATGGG + Intergenic
958543401 3:95509853-95509875 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
958560532 3:95743016-95743038 TAGGCCTCAAGGCCTGTGATGGG + Intergenic
958583871 3:96061355-96061377 TAGGCCTCCAGGTCTGTGATAGG - Intergenic
958638887 3:96779626-96779648 TATGCCTCCAGGCCTGGGATAGG - Intergenic
958710179 3:97708677-97708699 TAGGCCTCCAGGCCTGTGTTGGG - Intronic
958857179 3:99399029-99399051 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
958893487 3:99805377-99805399 CAGGCCTCCAGGCCTGTGATGGG + Intergenic
959140992 3:102486761-102486783 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
959171402 3:102848266-102848288 GAGGCCTCCAGTCCTGTGATGGG + Intergenic
959183216 3:103008175-103008197 TAGGCCTCTAAGACTGTGATGGG + Intergenic
959342587 3:105149433-105149455 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
959873885 3:111359870-111359892 TAGGCCTCCAGGGCTGTGGTGGG - Intronic
959968364 3:112381327-112381349 TAGGCCTCCAGGCCTGTGATTGG - Intergenic
959973375 3:112431800-112431822 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
960060182 3:113312616-113312638 TAGGCCTCCAGGCCTGTGATGGG - Intronic
960341328 3:116478867-116478889 TAGGCCTCCAGACCTGTGATGGG - Intronic
960486468 3:118259084-118259106 TAGGCCCCCAGGCCTGTGATGGG - Intergenic
960496690 3:118383887-118383909 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
960541920 3:118871187-118871209 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
960563894 3:119114105-119114127 TAAGCCTCCAGGCCTGTGATGGG + Intronic
960564450 3:119118530-119118552 TAGGCCTCCAGGCCTCTGATGGG + Intronic
961029752 3:123591180-123591202 TAGGCCTCTAGGTCTGTGATGGG + Intergenic
961067843 3:123891192-123891214 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
961068007 3:123892428-123892450 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
961342650 3:126238788-126238810 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
961701861 3:128750815-128750837 TAGGCCTCCAGGCCTGTGATGGG - Intronic
961961929 3:130864567-130864589 CAGGCCTCCAGGCCTGTGATGGG - Intronic
962162220 3:133011911-133011933 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
962339538 3:134570112-134570134 TAGGCCTCCAGGCCTGTGATGGG + Intronic
962421635 3:135233986-135234008 TAGGCCTCCAGGTCTGTGATGGG + Intronic
962509435 3:136084144-136084166 TAGGCCTCCAGGCCTGTGATGGG - Intronic
962576882 3:136763202-136763224 GACACCTCCAGGCCTGTGATGGG - Intergenic
962646459 3:137445333-137445355 TAGGCCTCCAGGCCTGTGACAGG + Intergenic
963022470 3:140885808-140885830 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
963072874 3:141319272-141319294 TAGGCCTCCAGACCTGTGATGGG + Intergenic
963114084 3:141710983-141711005 GAGACTTCCAGGCCTGTGATTGG - Intergenic
963297064 3:143557996-143558018 TAGGCCTCCAGGCCTGTGATGGG - Intronic
963339816 3:144020382-144020404 TAGGCTTCCAGGTCTGTGATGGG + Intronic
963391202 3:144665859-144665881 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
963515834 3:146306724-146306746 GAGGCCTCTGGGCCTGTGATGGG + Intergenic
963584641 3:147170101-147170123 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
963593041 3:147286754-147286776 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
963683591 3:148410688-148410710 TAGGCCTCCAGGACTGTGATGGG + Intergenic
964520731 3:157563684-157563706 TAGGCCTCCAGGCCTGTGATGGG + Intronic
964737855 3:159934470-159934492 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
964792963 3:160470320-160470342 TAAGCCTCCAGGCCTGTGATGGG - Intronic
964836116 3:160940416-160940438 CGGGCCTCCAGGCCTGTGATGGG - Intronic
964954392 3:162334699-162334721 TAGGCCTCCAGGCCTGTGATTGG - Intergenic
964989161 3:162785216-162785238 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
965066583 3:163857838-163857860 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
965083378 3:164064481-164064503 TAGGCCTCCAGGCCTATGATGGG - Intergenic
965115539 3:164483132-164483154 CAGGACTCTAGGACAGAGATTGG - Intergenic
965127497 3:164649486-164649508 TAGGTCTCCAGGACTGTGATGGG - Intergenic
965146617 3:164913148-164913170 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
965305588 3:167059550-167059572 TAGGCTTCCAGGCCAGAGATGGG + Intergenic
965455652 3:168896650-168896672 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
965809714 3:172579155-172579177 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
965854629 3:173073378-173073400 TAGGCCTTCAGGCCTGTGATGGG - Intronic
965897474 3:173595001-173595023 TAGGCCTCCAAGCCTGTGATGGG + Intronic
965990372 3:174810843-174810865 TAGGCCTCCAGGCCTGTGATGGG - Intronic
966074994 3:175924961-175924983 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
966333443 3:178840784-178840806 AATGCCTCCAGGCCTGTGATGGG + Intronic
966452614 3:180078813-180078835 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
966761047 3:183419286-183419308 TAGGCCTCTGGGACTGTGATGGG + Intronic
966925101 3:184639604-184639626 GAGTCCTCCAGGGCTGGGAAAGG + Intronic
967155031 3:186684165-186684187 TAGGCCTCCAGATCTGTGATGGG + Intergenic
967396535 3:189015568-189015590 TAAGCCTCCAGGACTGGGATGGG - Intronic
967406159 3:189118533-189118555 TAGGCCTCCAGGCCTGTGACAGG - Intronic
967513709 3:190341559-190341581 TAGGCCTCCAGGTCTGTGATGGG + Intronic
967519901 3:190416942-190416964 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
967634430 3:191784484-191784506 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
967635055 3:191791154-191791176 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
967695781 3:192528939-192528961 TAGTCCTCTAGGCCTGAGATGGG + Intronic
968695892 4:2026299-2026321 TAGGCCTCCAGACCTGTGATGGG + Intronic
968805185 4:2767556-2767578 GGGGCCTGCAGGACTGGGCTAGG - Intergenic
969177082 4:5406795-5406817 TAGGCCTCCAGGCCTATGATGGG + Intronic
969534724 4:7748740-7748762 GAGACCTCCGGGATTGAGAAGGG - Intergenic
969895123 4:10296540-10296562 GGGGTCTCCATGACTGAGCTGGG - Intergenic
969993102 4:11284150-11284172 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
970047870 4:11876305-11876327 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
970057618 4:11993639-11993661 GAGGCCTCTGGGCCTGTGATGGG - Intergenic
970217668 4:13776683-13776705 TAGGCCTCCAGGCCTTTGATGGG + Intergenic
970240330 4:14002499-14002521 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
970302040 4:14691946-14691968 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
970339190 4:15086462-15086484 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
970344072 4:15136186-15136208 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
970382158 4:15518895-15518917 TAGGCCTTCAGGCCTGTGATGGG + Intronic
970462015 4:16284192-16284214 TAGGCCTCCGGGCCTGTGATGGG - Intergenic
970554264 4:17215392-17215414 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
970665836 4:18335062-18335084 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
970678320 4:18477571-18477593 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
970715158 4:18913255-18913277 TAGGCCTTCAGGTCTGTGATGGG - Intergenic
970750478 4:19353336-19353358 TAGGTCTCCAGGCCTGTGATTGG + Intergenic
970818899 4:20190522-20190544 TAGGCCTCCAGGCCTGTGGTGGG - Intergenic
970987684 4:22176983-22177005 TAGGTCTCCAGGTCTGTGATCGG + Intergenic
971510417 4:27417144-27417166 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
971557878 4:28037008-28037030 TAGGCCTCCAGACCTGTGATGGG + Intergenic
971570498 4:28205089-28205111 TAGGCCTCCAGGTCTGTGATTGG + Intergenic
971601324 4:28595715-28595737 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
971793703 4:31199874-31199896 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
971892582 4:32544220-32544242 TAGGCCTCTAGGCCTGTGATAGG - Intergenic
971948643 4:33315142-33315164 TAGGCCTCCAGGCCTGTGTTGGG - Intergenic
972251335 4:37305258-37305280 TAGGTCTCCAGGCCTGTGATGGG + Intronic
972370599 4:38419646-38419668 TAGACCTCCAGGCCTGTGATGGG + Intergenic
972890696 4:43553340-43553362 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
973010712 4:45069553-45069575 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
973078646 4:45962281-45962303 TAGGCCTCCAGGCCTGTGACTGG + Intergenic
973673960 4:53245242-53245264 CGGGCCTCATGGACTGAGATAGG - Intronic
974012990 4:56624502-56624524 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
974202174 4:58656545-58656567 TAGGCCTCCAGACCTGTGATGGG - Intergenic
974215501 4:58841762-58841784 CAGGCCTCCGGGCCTGTGATGGG - Intergenic
974495008 4:62615120-62615142 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
974628505 4:64453869-64453891 CAGGCCTTCAGGACTGTGATGGG + Intergenic
974843349 4:67323180-67323202 TAGGCCTTCAGGCCTGTGATGGG - Intergenic
974846065 4:67352070-67352092 TAGGCCTCCAGGCCTGAGATGGG + Intergenic
974872454 4:67660323-67660345 TAGGCCTCCAGGTCTGTGATGGG - Intronic
974897568 4:67957804-67957826 TAGGTCTCCAGGCCTGTGATGGG - Intronic
974952907 4:68603701-68603723 TAGGACTCCAGGCCTGTGATGGG - Intronic
975052595 4:69883976-69883998 TAGGCCTCCAGACCTGTGATGGG + Intergenic
975216463 4:71761601-71761623 TAGGTCTCCAGGCCTGTGATGGG - Intronic
975257518 4:72255461-72255483 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
975361356 4:73475361-73475383 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
975507059 4:75149008-75149030 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
975729275 4:77321495-77321517 TAGGCCTCCAGGCCTGTGATGGG + Intronic
975917899 4:79347024-79347046 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
975952304 4:79788791-79788813 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
976000823 4:80371281-80371303 TAGGCCTCCAGGCCTGTGATGGG + Intronic
976042765 4:80906832-80906854 TAGTCCTCCAGAACTGTGATGGG + Intronic
976057049 4:81081225-81081247 TCGGCCTCCAGGCCTGTGATGGG - Intergenic
976283392 4:83347182-83347204 TAGTCCTCCAGGCCTGTGATGGG + Intergenic
976286475 4:83375727-83375749 CTGGCCTCCAGGCCTGTGATGGG + Intergenic
976287613 4:83385299-83385321 TAGGCATCCAGGTCTGTGATGGG + Intergenic
976405653 4:84658357-84658379 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
976503180 4:85815161-85815183 CAGGCCTCCAGGACTGTGATGGG + Intronic
976804982 4:89036682-89036704 TAGGCCTCCAGCCCTGTGATGGG - Intronic
976842321 4:89445793-89445815 TAGGCCTCCAGGCCTCTGATGGG + Intergenic
976952420 4:90849939-90849961 TAGGCCTCCAGGCCTTGGATGGG - Intronic
976988108 4:91327502-91327524 TAGGCCTCCAGGCCTGTGATGGG + Intronic
977063840 4:92288561-92288583 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
977097991 4:92769842-92769864 TAGGCCTTCAGGCCTGTGATGGG + Intronic
977309402 4:95366483-95366505 GAGCCATCCAGGAAAGAGATTGG - Intronic
977415941 4:96733279-96733301 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
977471335 4:97447445-97447467 TAGGCCTCTAGGCCTGTGATAGG - Intronic
977512004 4:97973605-97973627 TAGGCCTCCAGGCCTGTGATGGG - Intronic
977545008 4:98367066-98367088 TAGGCCTCCAGGCCTGTGATGGG - Intronic
977783384 4:101005621-101005643 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
977952883 4:102993994-102994016 TAGGTCTCCAGGCCTGTGATGGG + Intronic
978043558 4:104099242-104099264 TAAGCCTCCAGGACTATGATGGG - Intergenic
978101123 4:104841623-104841645 TAGGCCTCCAGGCCTATGATGGG + Intergenic
978145368 4:105365962-105365984 TAGTCCTCCAGGCCTGTGATTGG - Intergenic
978210685 4:106132211-106132233 TAGGCCTCCAGGCCTGTGATAGG - Intronic
978234982 4:106447024-106447046 TAGGCCTCCAGGCCTGTGGTGGG + Intergenic
978330875 4:107611674-107611696 GGGGCCTCCAGGCCTGTGATGGG - Intronic
978492493 4:109323594-109323616 TAGGCCCCCAGGCCTGTGATGGG + Intergenic
978654727 4:111051959-111051981 TAGACCTCCAGGTCTGTGATGGG - Intergenic
978666057 4:111183189-111183211 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
978774388 4:112491029-112491051 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
978915733 4:114124274-114124296 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
978920333 4:114175638-114175660 TAGGCTTCCAGGCCTGTGATAGG + Intergenic
978991202 4:115084507-115084529 TAGGCCTCCAGGCCTGTGATGGG - Intronic
979049410 4:115910615-115910637 TAGGCTTCCAGGACTATGATGGG + Intergenic
979136192 4:117115090-117115112 TAGGCCTCCAGACCTGCGATGGG + Intergenic
979368052 4:119848511-119848533 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
979391949 4:120138384-120138406 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
979411429 4:120384419-120384441 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
979775263 4:124582014-124582036 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
979856234 4:125637431-125637453 TAGGCCTCCAGGCCTATGATTGG + Intergenic
979895890 4:126156730-126156752 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
979895910 4:126156824-126156846 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
979969221 4:127114060-127114082 GAGGCCTCTGGGCCTGTGATGGG - Intergenic
980202740 4:129677079-129677101 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
980346800 4:131633016-131633038 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
980458249 4:133073042-133073064 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
980458660 4:133076601-133076623 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
980494925 4:133578118-133578140 TAGGACTCCAGGCCTGTGATGGG - Intergenic
980525731 4:133989120-133989142 TAGGCCTCTAGGGCTGTGATAGG + Intergenic
980596489 4:134962136-134962158 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
980646071 4:135643994-135644016 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
980654106 4:135759614-135759636 TAGGCCTCCAGGTCTCTGATCGG + Intergenic
980670226 4:135995042-135995064 GAGGCCTCTGGGCCTGTGATGGG + Intergenic
980702768 4:136454622-136454644 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
980758040 4:137190994-137191016 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
981176907 4:141692268-141692290 TAGGCCTCCAGGCCTGTAATGGG + Intronic
981191784 4:141872637-141872659 TAGGCCTCCAGGTCTTTGATGGG + Intergenic
981242347 4:142492911-142492933 TAGGTCTCCAGGGCTGTGATGGG - Intronic
981275372 4:142893218-142893240 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
981308043 4:143267597-143267619 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
981356914 4:143799411-143799433 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
981368445 4:143930008-143930030 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
981378242 4:144040293-144040315 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
981503151 4:145473692-145473714 TAGGCCTCCAGGCCTGGAATGGG + Intergenic
981795336 4:148589344-148589366 TAGGCCTCCGGGTCTGTGATGGG - Intergenic
981861449 4:149361437-149361459 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
981862859 4:149378866-149378888 CAGGCCTCCAGGTTTGTGATGGG - Intergenic
981915320 4:150026883-150026905 TAGGTCTCCAGGGCTGTGATGGG - Intergenic
981994232 4:150958450-150958472 CAGGACTCCAGGCCTGTGATGGG + Intronic
982098623 4:151946850-151946872 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
982121298 4:152145840-152145862 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
982162845 4:152587274-152587296 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
982299837 4:153867541-153867563 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
982301163 4:153880879-153880901 TAGGCCTCCAGGCCTTTGATGGG - Intergenic
982551911 4:156812846-156812868 GAGGGGTGCAGGACAGAGATGGG - Intronic
982554235 4:156840190-156840212 TAGGCCTCCATGCCTGTGATGGG - Intronic
982797621 4:159664349-159664371 TAGGCCTTCAGGTCTGTGATAGG + Intergenic
982805212 4:159754955-159754977 TAGACCTCCAGGCCTGTGATGGG - Intergenic
982829602 4:160043458-160043480 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
982917258 4:161227695-161227717 TATGCCTCCAGGCCTGTGATGGG + Intergenic
983006351 4:162490202-162490224 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
983105600 4:163682443-163682465 CAGGCCTCTAGGCCTGTGATGGG - Intronic
983379074 4:166968379-166968401 TAGGCCTCCAGGCCTGTGATGGG - Intronic
983657551 4:170098427-170098449 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
983785868 4:171729030-171729052 TAGGCCTCCAGGACTATGATGGG - Intergenic
983812291 4:172077838-172077860 TAGGTCTCCAGGCCTGTGATGGG - Intronic
983825090 4:172249550-172249572 TAGGCCTCCAGGTTTGTGATGGG - Intronic
983860713 4:172702701-172702723 GAAGCCTCTAGAACTGAGAGAGG + Intronic
983886751 4:172988638-172988660 TAGGCCTCCAGGCCTGTGATGGG - Intronic
984026281 4:174547390-174547412 TAGGCCTCCAGGTCTGTGATAGG - Intergenic
984057058 4:174942657-174942679 TAGGCTTCCAGGACTGTGATGGG + Intronic
984318608 4:178161522-178161544 TAGGCCCCCAGGCCTGTGATGGG + Intergenic
984553343 4:181185694-181185716 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
984587262 4:181578539-181578561 GAGGCTGCCAGTGCTGAGATCGG + Intergenic
984699849 4:182811860-182811882 TAGACCTCCAGGCCTGTGATGGG + Intergenic
984865487 4:184277136-184277158 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
984900399 4:184581049-184581071 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
985220269 4:187696787-187696809 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
985224983 4:187750820-187750842 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
985241793 4:187937991-187938013 GAGGCCTCTAGGACTGCGGTAGG + Intergenic
985371701 4:189292153-189292175 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
985443247 4:190000426-190000448 TAGGCCTCAAGGCCTGTGATTGG + Intergenic
985474076 5:68400-68422 TAGGCCTCCATGACTGTGATGGG - Intergenic
985809139 5:2070430-2070452 AGGGCCTCCAGGCCTGTGATGGG - Intergenic
986105555 5:4656149-4656171 TAGGCCTCCAGGCCTATGATGGG + Intergenic
986258751 5:6124144-6124166 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
986455342 5:7912558-7912580 TAGGCCTCTGGGACTGTGATGGG + Intergenic
986496284 5:8344786-8344808 AAGGCCTCCAGGCCTGTGATAGG + Intergenic
986601516 5:9477940-9477962 TGGGCCTCCAGGCCTGTGATAGG - Intronic
986680140 5:10224824-10224846 CAGGCCTCCAGGCTTGTGATGGG + Intergenic
986780180 5:11058249-11058271 TAGGCCTCCAGGCCTGTGGTGGG - Intronic
986949191 5:13060886-13060908 TAGGACTCCAGGCCTGTGATAGG + Intergenic
987000025 5:13651224-13651246 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
987201757 5:15584185-15584207 TAGTCCTCCAGGCCTGTGATGGG + Intronic
987216617 5:15744043-15744065 TAGGCCTCCAGGCCTGTGAAGGG + Intronic
987433515 5:17865182-17865204 TAGGCCTCCAGGCCTATGATGGG - Intergenic
987457596 5:18165915-18165937 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
987510283 5:18828580-18828602 TAGGTCTCCAGGTCTGTGATGGG - Intergenic
987515949 5:18908031-18908053 GAGGCATCCCTGACTGAGAAAGG - Intergenic
987542762 5:19276633-19276655 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
987545950 5:19310134-19310156 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
987597478 5:20020432-20020454 TAGGCCTCCAGGCCTTTGATGGG - Intronic
987602122 5:20084895-20084917 TAGGCCTCCAGGCTTGTGATGGG + Intronic
987650436 5:20733437-20733459 TAGGCCTTTAGGACTGTGATGGG + Intergenic
987675004 5:21063292-21063314 TAGGCCTCCAGGCCTGTGATAGG - Intergenic
987792083 5:22581191-22581213 TAGGCCTTCAGGCCTGTGATGGG - Intronic
987802881 5:22721103-22721125 TAGGCCTTCAGGCCTGTGATGGG - Intronic
987881482 5:23750940-23750962 TAGGCCTGCAGGCCTGTGATAGG + Intergenic
987984852 5:25133825-25133847 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
988016256 5:25563638-25563660 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
988031669 5:25771224-25771246 TAGGCCTCCAGGCCTAGGATGGG - Intergenic
988061414 5:26175420-26175442 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
988074821 5:26338929-26338951 TTGGCCTCCAGGCCTGTGATGGG + Intergenic
988134839 5:27157844-27157866 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
988159701 5:27503248-27503270 TAGGCCTCCCGGACTATGATGGG + Intergenic
988256185 5:28823120-28823142 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
988353550 5:30143087-30143109 TAGACCTCCAGGCCTGTGATGGG + Intergenic
988647251 5:33108252-33108274 TAGGCCTCCAGAACTGTAATGGG - Intergenic
988745113 5:34128019-34128041 TAGGCCTTTAGGACTGTGATGGG - Intergenic
988928523 5:36013362-36013384 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
989067842 5:37481619-37481641 TAAGCCTCCAGGCCTGTGATGGG + Intronic
989389146 5:40882442-40882464 TGGGCCTCCAGGCCTGTGATTGG - Intergenic
989434636 5:41397189-41397211 CAGGCCTCCAGGCCTGTGATAGG - Intronic
989507764 5:42247140-42247162 TAGACCTCCAGGCCTGAGATGGG + Intergenic
989656816 5:43753645-43753667 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
989778157 5:45233359-45233381 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
989787118 5:45345278-45345300 TAGACCTCCAGGTCTGTGATGGG + Intronic
990075793 5:51844131-51844153 TGGGCCTCCAGGTCTGTGATGGG + Intergenic
990077789 5:51872932-51872954 TAGGCCTCCAGAACTGTGGTGGG - Intergenic
990083357 5:51944633-51944655 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
990127038 5:52531562-52531584 GAGGCCTCTGGGTCTGTGATGGG + Intergenic
990213762 5:53508318-53508340 TAGGCCTCCAGGCCTGTGAAGGG + Intergenic
990291211 5:54354069-54354091 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
990526032 5:56628802-56628824 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
990794472 5:59524685-59524707 TAGGCCTCCAGGCCTGTAATAGG - Intronic
990844616 5:60122647-60122669 TAGGCTTCCAGGCCTGTGATGGG + Intronic
990883797 5:60569137-60569159 TAGACCTCCAGGACTATGATTGG + Intergenic
990903630 5:60779644-60779666 TAGGCCTCCAGGTCTGTGACGGG + Intronic
990939527 5:61188006-61188028 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
991116893 5:62964638-62964660 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
991122502 5:63032470-63032492 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
991136217 5:63185566-63185588 TAGGCCTCCAGGTCTATGATGGG - Intergenic
991184902 5:63795183-63795205 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
991355796 5:65767505-65767527 TAGGCCTCCAGGCCTGTGATGGG + Intronic
992225323 5:74614736-74614758 GGGGGCACCAGGACTGAAATTGG + Intergenic
992375698 5:76185723-76185745 TAGGCCTCCAGGCCTGTGATGGG + Intronic
992817948 5:80463490-80463512 CAGGCCTCCAGGCCTGTAATGGG + Intronic
993024121 5:82626561-82626583 TAGGCCTCCAGGGCTGTGATGGG - Intergenic
993084640 5:83348600-83348622 TAGGCCTCCTGGCCTGTGATGGG + Intronic
993143234 5:84060792-84060814 GAGGCCTCCAGTAATGAGACAGG - Intronic
993256066 5:85591501-85591523 GGGGCCTCCAGGCCTCTGATGGG + Intergenic
993285472 5:85990942-85990964 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
993309653 5:86313671-86313693 GGGGCCTCCAGGCCTGTGATGGG - Intergenic
993531193 5:89027270-89027292 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
993703846 5:91148309-91148331 TAGGCCTCCGGGCCTGTGATGGG - Intronic
993761339 5:91800521-91800543 TAGGCCTCTAGGTCTGTGATGGG + Intergenic
994019247 5:95004486-95004508 TAGGCCTCCTGGCCTGTGATGGG - Intronic
994252905 5:97557751-97557773 GGAGCCTTCAGGAATGAGATTGG + Intergenic
994425160 5:99576343-99576365 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
994436178 5:99735890-99735912 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
994440839 5:99800806-99800828 TAGGCCTCAAGGCCTGTGATAGG + Intergenic
994524160 5:100882624-100882646 TAGGTCTCCAGGTCTGTGATGGG - Intronic
994580313 5:101632960-101632982 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
994637729 5:102363621-102363643 TAGGCCTCCAGGCCTGCGATGGG + Intergenic
994655999 5:102593607-102593629 TAGACCTCCAGGCCTGTGATGGG + Intergenic
994808205 5:104479154-104479176 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
994823279 5:104680516-104680538 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
994833048 5:104810366-104810388 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
994849524 5:105036222-105036244 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
995055365 5:107753582-107753604 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
995120707 5:108532734-108532756 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
995299798 5:110566257-110566279 TAGGCCTCCAAGACTGTGATGGG + Intronic
995370178 5:111409480-111409502 AAGGCCTCCAGGCCTGTGATGGG + Intronic
995392450 5:111653647-111653669 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
995724177 5:115167228-115167250 TAGGCCTCCAGGCCTGTGATGGG + Intronic
995779847 5:115763163-115763185 TAGGCCTCCAGGTCTTTGATAGG + Intergenic
996030972 5:118703449-118703471 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
996246612 5:121271662-121271684 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
996388482 5:122934186-122934208 GCGGCCTCCAGGACGGCGCTGGG - Intronic
996497328 5:124174751-124174773 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
996605276 5:125313802-125313824 TAGACCTCCAGGCCTGTGATGGG + Intergenic
996670559 5:126113002-126113024 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
996853173 5:127975669-127975691 TAGGCACCCAGGACTGAGATAGG + Intergenic
997016261 5:129938273-129938295 TGGGCCTCCAGGCCTGTGATGGG + Intronic
997022090 5:130013722-130013744 CAGGCCTCCAGGCCTGCAATGGG + Intronic
997081666 5:130746805-130746827 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
997088363 5:130827244-130827266 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
997108279 5:131046142-131046164 TAGACCTCCAGGCCTGTGATGGG + Intergenic
997116097 5:131127258-131127280 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
997181458 5:131832916-131832938 TAGGCCTCCAGGCCTGTGATGGG + Intronic
997182347 5:131843203-131843225 CAGGCCTCCAGGCCTGTGATGGG + Intronic
997205987 5:132050484-132050506 CAGGTATCCAGGCCTGAGATAGG + Intergenic
997351962 5:133237195-133237217 GAGGGCTGCAGGACGGAGAAGGG - Intronic
997789292 5:136742931-136742953 TAGGCCTGCAGGCCTGTGATGGG - Intergenic
998144621 5:139720122-139720144 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
998581902 5:143385239-143385261 TAGACCTCCAGGCCTGTGATAGG + Intronic
998697138 5:144653023-144653045 TAGGCCTCCAGCCCTGTGATAGG + Intergenic
998759082 5:145412063-145412085 TAGGCTTCCAGGACTATGATGGG + Intergenic
998813978 5:145993748-145993770 TAGGCCTCCAGGCCTGTGATGGG + Intronic
998926102 5:147127965-147127987 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
998980517 5:147697520-147697542 TAGGCCTCCAGGCCTGTGATGGG - Intronic
999504459 5:152180334-152180356 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
999541039 5:152572944-152572966 TAGGCCTACAGGCCTGTGATGGG - Intergenic
999571574 5:152925547-152925569 TAGGCCTCTGGGTCTGAGATGGG - Intergenic
1000229146 5:159298639-159298661 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1000516030 5:162237037-162237059 TAGGCCTCCAGTCCTGTGATGGG + Intergenic
1000575106 5:162966983-162967005 TAGGCCTCCAGGACTATGAAGGG + Intergenic
1000609582 5:163359688-163359710 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1000777920 5:165442405-165442427 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1001121177 5:168981401-168981423 GGGGCCTCAAGGACTGAGGCAGG + Intronic
1001181704 5:169526438-169526460 TGGGCCTCCAGGCCTGTGATAGG + Intergenic
1001218113 5:169874763-169874785 GAGGCCTGAGGGACTGAGAGAGG + Intronic
1001471408 5:172015757-172015779 GAGGGCTCATGGACTCAGATTGG - Intergenic
1001473437 5:172032096-172032118 TAGGCCTCCAGTACTGTGATGGG + Intergenic
1001481505 5:172092153-172092175 GAGGCCGGCAGGAGTGAGAGTGG + Intronic
1001944470 5:175767167-175767189 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1002594345 5:180312282-180312304 AAGGCCTCCAGGAGGGAGTTGGG + Intronic
1002757081 6:172421-172443 CAGGCCTTCAGGGCTGTGATGGG - Intergenic
1002869771 6:1156568-1156590 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
1003227905 6:4223216-4223238 AAGGCCTCCAGGTGTGTGATTGG - Intergenic
1003401799 6:5796589-5796611 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1003484465 6:6563567-6563589 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1003798283 6:9630690-9630712 TAGGCCTCTAGGTCTGTGATGGG - Intronic
1003838247 6:10093759-10093781 TAGGTTTCCAGGACTGTGATGGG + Intronic
1004076903 6:12351827-12351849 TAGGCCTCCAGACCTGTGATGGG + Intergenic
1004311121 6:14546043-14546065 CTGGCCTCCAGGACTGTGAGAGG - Intergenic
1005543235 6:26835773-26835795 TAGGCCTTTAGGACTGTGATGGG - Intergenic
1005714605 6:28534875-28534897 GAGGAATCCAGGGTTGAGATGGG - Exonic
1005982945 6:30851526-30851548 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1006217029 6:32453344-32453366 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1006344112 6:33466237-33466259 TGGGCCTCCAGGACTGTGATGGG - Intergenic
1006618067 6:35343021-35343043 GAGGCCCCCGGGCCTGAGACGGG - Intronic
1006697092 6:35940546-35940568 TGGGCCTCCAGGCCTGTGATTGG - Intergenic
1007346649 6:41236310-41236332 GAGGTCTCTGGGACTGAGAGGGG - Intronic
1007975320 6:46095185-46095207 TACGCCTCCAGGTCTGTGATGGG + Intergenic
1008127210 6:47682222-47682244 GATGCCACCAGGACTGACTTGGG - Exonic
1008220911 6:48852459-48852481 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1008261041 6:49366766-49366788 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1008567444 6:52783137-52783159 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
1008571602 6:52822042-52822064 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
1008756088 6:54797081-54797103 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1008820883 6:55629619-55629641 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
1008859621 6:56133640-56133662 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1009014062 6:57877938-57877960 TAGGCCTTTAGGACTGTGATGGG - Intergenic
1009345595 6:62610099-62610121 TAGGCATCCAGGCCTGTGATGGG + Intergenic
1009527431 6:64764517-64764539 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1009547024 6:65033421-65033443 TAGGCCTCCTGGCCTGTGATGGG - Intronic
1009607825 6:65896552-65896574 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1009637075 6:66280366-66280388 TAGGCCTCCAGGCCTCTGATGGG - Intergenic
1009680164 6:66881340-66881362 TAGGCCTCCAGGTTTGTGATGGG + Intergenic
1009715854 6:67394424-67394446 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1009729281 6:67579058-67579080 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1009732941 6:67634121-67634143 TAGGCCTCCATGCCTGTGATGGG - Intergenic
1009772435 6:68160911-68160933 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1009792341 6:68419865-68419887 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1009804984 6:68590940-68590962 CAGGCCTTCAGGCCTGTGATGGG + Intergenic
1009826044 6:68867146-68867168 TAGGCCTCCAGGTCTGTGATGGG - Intronic
1010055085 6:71556011-71556033 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
1010074386 6:71783729-71783751 TAGACCTCCAGGCCTGTGATTGG + Intergenic
1010263704 6:73844848-73844870 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1010536574 6:77038438-77038460 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1010605907 6:77889712-77889734 TAGGACTCCAGGCCTGTGATGGG - Intronic
1010611826 6:77962865-77962887 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1010651068 6:78455841-78455863 GAGCCCTCCAGGCCTGTGATGGG + Intergenic
1010735899 6:79443321-79443343 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1010978372 6:82341564-82341586 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1011031685 6:82930960-82930982 TAGGCCTCCAGGCCTGTTATGGG - Intronic
1011041115 6:83031730-83031752 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1011110584 6:83833454-83833476 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1011152561 6:84290289-84290311 TAGGCCTCCATGCCTGTGATGGG + Intergenic
1011218927 6:85033778-85033800 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1011294130 6:85808462-85808484 TAGGCCTCCAGATCTGTGATGGG + Intergenic
1011867913 6:91854286-91854308 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1011895220 6:92216895-92216917 TAGGCCTCCAAGCCTGTGATGGG - Intergenic
1011948356 6:92934844-92934866 TAGGCCTACAGGCCTGTGATAGG + Intergenic
1012005381 6:93707504-93707526 TAGGCCTCCAGGCCTACGATGGG - Intergenic
1012019911 6:93905315-93905337 GAGACCTCCAGGCCTGTGATGGG + Intergenic
1012070262 6:94604933-94604955 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1012141456 6:95631438-95631460 TAGGCCTCCAGGCCTGTGTTGGG - Intergenic
1012161369 6:95888993-95889015 TAGACCTCCAGGACTGTGATGGG + Intergenic
1012179908 6:96139837-96139859 GGGGCCTCCATGCCTGTGATTGG + Intronic
1012195404 6:96335508-96335530 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
1012723820 6:102783558-102783580 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1012755721 6:103227940-103227962 TAGGCCTCTAGGCCTGTGATGGG - Intergenic
1012768248 6:103396898-103396920 TAGGCCTCCAAGCCTGTGATCGG - Intergenic
1012780125 6:103546982-103547004 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1012823810 6:104123450-104123472 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1012825408 6:104140380-104140402 TATGCCTCCAGGCCTGCGATGGG + Intergenic
1012830763 6:104201369-104201391 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1013086600 6:106863010-106863032 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1013338627 6:109191525-109191547 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1013503080 6:110771512-110771534 TAGGACTCCAGGCCTGTGATGGG + Intronic
1013925222 6:115464109-115464131 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1013927912 6:115494769-115494791 TAGGCCTCCAGGCCTGTGACGGG + Intergenic
1014042919 6:116850561-116850583 AAGGCCTCCAGGCCTGTGAGGGG - Intergenic
1014067726 6:117146162-117146184 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1014342641 6:120228491-120228513 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1014407423 6:121068906-121068928 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1014562980 6:122913703-122913725 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1014691642 6:124570403-124570425 TGGGCCTCCAGGACTGTGATGGG - Intronic
1014714515 6:124848915-124848937 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1014771118 6:125458703-125458725 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1014771751 6:125465464-125465486 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1014861190 6:126470152-126470174 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1014875550 6:126654865-126654887 TAGGCCTCCAGGACTGTGATGGG - Intergenic
1015252532 6:131142283-131142305 TAGGCCTCCAGGTCTGTGATCGG - Intronic
1015576213 6:134673931-134673953 GAGGCCTCCTGGTCAGAGGTGGG + Intergenic
1015652463 6:135478790-135478812 TAGGCTTCCAGGCCTGTGATAGG - Intronic
1015677139 6:135762590-135762612 TAGGCTTCCAGGTCTGTGATGGG + Intergenic
1015815636 6:137208424-137208446 TAGGCCTCCGGGCCTGTGATGGG - Intronic
1015853028 6:137593856-137593878 TAGGCCTCCAGTCCTGTGATGGG + Intergenic
1016094680 6:140020697-140020719 TAGACCTCCAGGGCTGTGATGGG + Intergenic
1016108132 6:140188320-140188342 GAGGCCTCTGGGCCTGTGATGGG - Intergenic
1016122717 6:140363957-140363979 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1016139733 6:140594150-140594172 TAGGCCTCCAGGCCTATGATAGG - Intergenic
1016151483 6:140747267-140747289 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1016209029 6:141505666-141505688 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1016281817 6:142426994-142427016 TAGGCCTCCAGGTCTGTGATGGG + Intronic
1016437154 6:144048701-144048723 TAGGCCTCCAGGTCTGTTATGGG + Intronic
1016595294 6:145791200-145791222 TAGGCCTCCAGGTCTGTGACAGG + Intergenic
1017245302 6:152217789-152217811 GTGGCTTCCAGGAGTGAGCTGGG + Intronic
1017437771 6:154433633-154433655 CAGTCCTGCAGGACTGGGATGGG + Intronic
1017525435 6:155237841-155237863 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1017580420 6:155859101-155859123 TAGGCCTCCAGGCTTGTGATTGG - Intergenic
1017654484 6:156614219-156614241 TAGGCCTCCAGGCCTATGATGGG + Intergenic
1017860595 6:158393772-158393794 TAGGCCTCCAGAGCTGTGATAGG + Intronic
1018184888 6:161258173-161258195 GAGACCTCAAAGACTGAGAGTGG + Intronic
1018502084 6:164422310-164422332 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1018514264 6:164561815-164561837 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1018554531 6:165036210-165036232 TAGGACTCCAGGCCTGTGATGGG - Intergenic
1018566906 6:165163765-165163787 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1018721531 6:166576883-166576905 TAGGCCTCCAGGCCTGCAATGGG - Intronic
1019019028 6:168902276-168902298 GACGTCTCCAGGACTGAACTTGG + Intergenic
1019135945 6:169907811-169907833 GGGGCCTCCTTGACTGAGAGTGG + Intergenic
1019150465 6:170002017-170002039 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1019150921 6:170005063-170005085 TAGGCCTACAGGTCTGTGATGGG + Intergenic
1019332908 7:469700-469722 GAGCCCTGCAGGACTGTGGTGGG + Intergenic
1020388273 7:7631675-7631697 TAGGTCTCCAGGCCTGTGATAGG - Intergenic
1020407733 7:7855622-7855644 TAGGCCTCCAGGCCTGTGGTGGG + Intronic
1020493846 7:8822504-8822526 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
1020611344 7:10401514-10401536 TAGGCCTCCAGGCCCGTGATGGG + Intergenic
1020729646 7:11865823-11865845 TAGGCCTCCGGGCCTGTGATGGG - Intergenic
1020864438 7:13539741-13539763 GATGAGTCCAGGACTGAGATGGG - Intergenic
1021001749 7:15340458-15340480 GAGGCCTCCTGGCCTGTGACAGG - Intronic
1021326365 7:19273769-19273791 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
1021529857 7:21632243-21632265 GAGGCCTCCAGGACTGAGATGGG + Intronic
1021646791 7:22796639-22796661 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1022352256 7:29577409-29577431 GAGGCCTCTGGGCCTGTGATGGG - Intergenic
1022492935 7:30834483-30834505 TAGGCCTCCGGGTCTGTGATGGG + Intronic
1023021931 7:36018832-36018854 GTGACCCCCAGGTCTGAGATTGG - Intergenic
1023188591 7:37555703-37555725 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1023650561 7:42364605-42364627 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1024015289 7:45308170-45308192 CAGGCCTCTAGGCCTGGGATAGG - Intergenic
1024415949 7:49107585-49107607 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1024487123 7:49931788-49931810 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1024778826 7:52822082-52822104 TAGGCCTCCAGGCCTGTTATGGG + Intergenic
1024984972 7:55186999-55187021 GAGGCCTCCTGGACAGGGAAAGG - Intronic
1025038519 7:55619063-55619085 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1026278644 7:68902651-68902673 TAGGCATCCAGGCCTGCGATGGG - Intergenic
1027180256 7:75934626-75934648 GAGGCCTCCACAACTGTAATGGG - Intronic
1027395291 7:77747373-77747395 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1027458552 7:78424087-78424109 TAGGCCTCCAGACCTGTGATGGG - Intronic
1027586728 7:80066851-80066873 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1027666440 7:81047038-81047060 TAGCCCTCCAGGCCTGTGATAGG - Intergenic
1027695492 7:81404821-81404843 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1027831521 7:83183125-83183147 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1027977553 7:85178803-85178825 TAGGCCTCCAGGCCTGTGACAGG - Intronic
1027990962 7:85360672-85360694 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1028011426 7:85649020-85649042 TGGGCCTCCAGGCCTGTGATAGG + Intergenic
1028133676 7:87205197-87205219 TAGGCCTCTAGGCCTGTGATGGG + Intronic
1028207188 7:88031729-88031751 CAGGCCTCCAGGCCTGTGATGGG - Intronic
1028431305 7:90749853-90749875 CATGCCCCCAGGACTGAGAAGGG + Intronic
1028516319 7:91681246-91681268 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1028653369 7:93174916-93174938 TAGGCCTCCAGGTCTATGATGGG - Intergenic
1028668395 7:93372648-93372670 TAGGCCTCCAGGCCTGAGATGGG + Intergenic
1030357362 7:108557150-108557172 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1030415437 7:109238003-109238025 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1030527693 7:110673362-110673384 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1030665881 7:112277931-112277953 TAGGCCTTCAGGACTGCCATAGG + Intronic
1030784318 7:113641150-113641172 GAAACCTCCAGGCCTGGGATAGG + Intergenic
1030986248 7:116245050-116245072 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1031170856 7:118290694-118290716 TAGGCCTCCAGGCCTGTGACAGG - Intergenic
1031182133 7:118432714-118432736 TAGGCCTCCAGGCCTGTGCTGGG - Intergenic
1031255001 7:119435782-119435804 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1031435651 7:121728893-121728915 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1031473117 7:122191199-122191221 TAGGCCTCCATGCCTGTGATGGG - Intergenic
1031573073 7:123383268-123383290 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1031608197 7:123794434-123794456 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1031725352 7:125230686-125230708 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1031732833 7:125319760-125319782 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1031787945 7:126058622-126058644 TAGGCCTCAAGGCCTGTGATAGG - Intergenic
1031818733 7:126472734-126472756 CAGGCCTCCAGGCCTGTGATGGG - Intronic
1032318227 7:130860990-130861012 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1032454003 7:132058190-132058212 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1033072804 7:138220448-138220470 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1033220777 7:139525064-139525086 GAGCCCTGGAGTACTGAGATGGG + Intronic
1033244536 7:139707066-139707088 GAGGCCTCCAGGAGTGTGCCTGG - Intronic
1033419768 7:141195065-141195087 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1033492067 7:141853656-141853678 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1033517923 7:142128491-142128513 GAGGCTTCCTGGCCTGTGATGGG - Intronic
1033760033 7:144427759-144427781 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1034011277 7:147531645-147531667 TGGGCCTCCAGGCCTGTGATGGG + Intronic
1034502054 7:151456946-151456968 TAGGCCTCTGGGACTGTGATGGG + Intergenic
1034718409 7:153264654-153264676 TAGGCCTCCAGGCGTGTGATGGG + Intergenic
1034728894 7:153366102-153366124 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1034751093 7:153569546-153569568 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1034751287 7:153571373-153571395 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1034751839 7:153576263-153576285 TAGGCCTCCAGGCCTGTGGTGGG - Intergenic
1034876194 7:154726586-154726608 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1034904847 7:154934771-154934793 TAGACCTCCAGGCCTGTGATAGG + Intronic
1035549517 8:509634-509656 CGGGCCTCCAGGCCTGTGATGGG + Intronic
1035713346 8:1735298-1735320 GAGGCTTCCAGAGGTGAGATGGG + Intergenic
1035951855 8:4030580-4030602 TAGACCTCCAGGCCTGTGATGGG + Intronic
1037205966 8:16320636-16320658 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1037415780 8:18648717-18648739 TAAGCCTCCAGGCCTGTGATAGG - Intronic
1037761866 8:21746893-21746915 CAGGCCTGCAGCCCTGAGATGGG - Intronic
1037979158 8:23238248-23238270 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1038880501 8:31605663-31605685 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1039107454 8:34004501-34004523 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1039121902 8:34157274-34157296 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1040310650 8:46235122-46235144 GAAGCCACCAGGACTGTAATGGG + Intergenic
1040314841 8:46255457-46255479 GAGGCCTCCAGGACTGTCCCAGG + Intergenic
1040397241 8:47011453-47011475 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1040542430 8:48372294-48372316 GAGGCCTCCATGGCAGAGAAAGG + Intergenic
1040559990 8:48515122-48515144 GACGCAGCCAGGACTGAGAACGG + Intergenic
1040644958 8:49387760-49387782 TAGACCTCCAGGGCTGTGATAGG - Intergenic
1040813368 8:51481586-51481608 TAGGCCTCCAGGCCAGTGATGGG - Intronic
1040966023 8:53082008-53082030 TAGACCTCCAGGCCTGTGATGGG - Intergenic
1041013798 8:53571013-53571035 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1041682433 8:60606874-60606896 AGGGCCTCCAGGCCTGTGATGGG + Intronic
1041849818 8:62378481-62378503 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1041865819 8:62571909-62571931 TAGGCCTCCAGGCCTGTGATTGG + Intronic
1041927528 8:63252084-63252106 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1042181109 8:66088346-66088368 TAGGCCTCCAGGCTTGTGATGGG + Intronic
1042501688 8:69515474-69515496 TAGGTCTCCAGGCCTGTGATTGG + Intronic
1042602488 8:70512392-70512414 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1042646124 8:70988099-70988121 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1042989293 8:74620734-74620756 TAGGCCTCCTGGCCTGTGATGGG + Intronic
1043065774 8:75568121-75568143 TAGGCCTCCAGGCCTGGGATGGG + Intergenic
1043214620 8:77570013-77570035 TAGGCCTCCAGGCCTTTGATGGG + Intergenic
1043426060 8:80150026-80150048 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1043518512 8:81019386-81019408 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1043749914 8:83922155-83922177 TAGGCATCCAGGAGTGTGATGGG + Intergenic
1043776684 8:84278378-84278400 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1043779494 8:84313258-84313280 TAGGCCTCTAGGCCTGTGATGGG + Intronic
1044066609 8:87706497-87706519 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1044087246 8:87956055-87956077 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1044205743 8:89490558-89490580 TAGGCCTCTAGGCCTGTGATAGG - Intergenic
1044220485 8:89663676-89663698 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1044273595 8:90275091-90275113 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1044303891 8:90616379-90616401 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1044324879 8:90847883-90847905 TTGGCCTCCAGGCCTGTGATGGG + Intronic
1044326871 8:90868915-90868937 TAGGCCTCCAGGCCTATGATGGG - Intronic
1044395661 8:91708134-91708156 TAGGCCTCCAGGACTGTGATTGG - Intergenic
1044504706 8:93004429-93004451 TAGGCCTCCAGGCCTGAGATGGG + Intronic
1044945446 8:97384780-97384802 TAGGCCTCCAGGCCTATGATGGG + Intergenic
1045050538 8:98320226-98320248 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1045053649 8:98349885-98349907 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1045207366 8:100056469-100056491 TAGGCCTCCAGGCCTATGATGGG - Intronic
1045617932 8:103939490-103939512 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1045884464 8:107079073-107079095 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1045919266 8:107510927-107510949 GAGGCTTCCAGGCCTGTGATGGG - Intergenic
1045995702 8:108359090-108359112 TAGGCCTCGAGGCCTGTGATGGG + Intronic
1046004165 8:108458704-108458726 TAGGACTCCAGGCCTGTGATGGG + Intronic
1046170334 8:110497701-110497723 TAGGCCTCCAAGTCTGTGATGGG - Intergenic
1046226382 8:111285760-111285782 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1046257714 8:111722389-111722411 AAGGTCTCCAGGCCTGTGATGGG + Intergenic
1046300215 8:112276984-112277006 TAGACCTCCAGGCCTGTGATGGG + Intronic
1046305267 8:112357572-112357594 TAGGCCTCTAGGCCTGTGATGGG - Intronic
1046400380 8:113697382-113697404 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1046433170 8:114154071-114154093 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1046495691 8:115010556-115010578 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
1046735118 8:117768560-117768582 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1046929000 8:119824588-119824610 TAGGCCTCCGGGCCTGTGATGGG - Intronic
1047586862 8:126282662-126282684 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1047937776 8:129798875-129798897 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
1048069750 8:131009205-131009227 TGGGCCTCCAGGCCTGTGATGGG - Intronic
1048222259 8:132552748-132552770 GAGGCAGCCAGGACTGAGGCGGG + Intergenic
1048478965 8:134770035-134770057 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1048658536 8:136571178-136571200 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1048668381 8:136689755-136689777 CAGGCCTCCAGGCCTGTGATGGG + Intergenic
1048712708 8:137229835-137229857 GAGGCATCAAAGACTGAGGTGGG - Intergenic
1048772821 8:137913200-137913222 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1048915804 8:139181888-139181910 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1049076259 8:140398881-140398903 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1049489677 8:142888677-142888699 TAGGTCTCCAGGCCTGTGATGGG + Intronic
1050072671 9:1832849-1832871 AAGGACTCCAGTACTGAGACAGG + Intergenic
1050121524 9:2313676-2313698 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1050635633 9:7609528-7609550 GAGGCATCCAGGACTTACAATGG - Intergenic
1050674572 9:8037120-8037142 TAAGCCTCCAGGCCTGTGATGGG + Intergenic
1051560174 9:18431809-18431831 GTGACCTCCAGGACTGAGCATGG + Intergenic
1051569048 9:18534935-18534957 TAGGCCTCTGGGACTGAGATGGG + Intronic
1051582766 9:18695159-18695181 TAGGCCTCCAGGCCTGTGATAGG + Intronic
1051767505 9:20540678-20540700 TAGGCCTCCAGGCCAGTGATGGG + Intronic
1051914993 9:22198011-22198033 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1051925172 9:22316790-22316812 TAGGCCTCCAGGCCTGTGACAGG - Intergenic
1051946182 9:22572767-22572789 TAGGCCTGCAGGCCTGTGATGGG - Intergenic
1052079116 9:24180790-24180812 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1052080769 9:24203241-24203263 TAGGCCTCCGGGACTGTGATGGG - Intergenic
1052156839 9:25202853-25202875 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1052187829 9:25620311-25620333 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1052267465 9:26590817-26590839 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1052294522 9:26882290-26882312 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1052594078 9:30536666-30536688 TAGGCCTCCAGGCTTGTGATGGG - Intergenic
1052625038 9:30963251-30963273 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1052666087 9:31496968-31496990 GAGGCTTCCAGGCCTGTGATGGG + Intergenic
1052702222 9:31950934-31950956 CAGACCTCCAGGCCTGTGATGGG + Intergenic
1052969467 9:34368221-34368243 TAGGCCTCCAGGCCTGTGATGGG + Exonic
1053879280 9:42575620-42575642 TAGGCCTCCTGGCCTGTGATGGG + Intergenic
1054169998 9:61829630-61829652 GAGGCCTCTGGGTCTGTGATGGG + Intergenic
1054232409 9:62526077-62526099 TAGGCCTCCTGGCCTGTGATGGG - Intergenic
1054667540 9:67751185-67751207 GAGGCCTCTGGGTCTGTGATGGG - Intergenic
1054797198 9:69313402-69313424 TAGGCCCCCAGGCCTGTGATGGG + Intergenic
1055141944 9:72886536-72886558 AAGGCCTCCAGGCCTGTGATGGG - Intergenic
1055363932 9:75524614-75524636 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1055615347 9:78066443-78066465 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
1055715019 9:79108434-79108456 TAAGCCTCCAGGCCTGTGATGGG - Intergenic
1055858848 9:80724401-80724423 TAGGCCTGCAGGCCTGTGATAGG + Intergenic
1056012418 9:82346190-82346212 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1056064227 9:82916470-82916492 TAGCCCTCCAGGCCTGTGATGGG + Intergenic
1056527359 9:87455634-87455656 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1056924430 9:90820657-90820679 TGGGCCTCCAGGTCTGTGATAGG + Intronic
1058004621 9:99902051-99902073 AAGGCCTCCAGGCCTGTGATGGG + Intergenic
1058222980 9:102325700-102325722 TAGGCTTCCAGGCCTGTGATTGG - Intergenic
1058323038 9:103658305-103658327 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1058385311 9:104429204-104429226 TAGGCCTGCAGGCCTGTGATGGG - Intergenic
1058949493 9:109890409-109890431 GAGCCCTCCAGGACAGCGAACGG + Intronic
1059082639 9:111266237-111266259 TAGGCCTCTAGGCCTGTGATGGG + Intergenic
1059187021 9:112283747-112283769 TAGGCCTCCAGGTCTGTGATGGG - Intronic
1059581774 9:115556660-115556682 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1059587299 9:115619910-115619932 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1060006183 9:120001859-120001881 GAGACCTCTGGGACTGAAATTGG - Intergenic
1060622666 9:125082077-125082099 TAGACCTCCAGGCCTGTGATGGG - Intronic
1061210072 9:129186331-129186353 GTGGCTTCCAGGACTCAGAATGG + Intergenic
1061278544 9:129583725-129583747 GTGGCCTCCAGGGCTGAGCCTGG - Intergenic
1061891868 9:133625942-133625964 TAGGCTTCCAGGCCTGTGATGGG + Intergenic
1061914273 9:133741141-133741163 CAGGCTTCCAGGACAGAGAGAGG + Intergenic
1062438732 9:136559464-136559486 CAGGCCTCCAGGCCTGTGATGGG - Intergenic
1062591325 9:137276118-137276140 GAGGCCTCCTGGAATGGGAATGG + Intergenic
1062670055 9:137703201-137703223 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1185876312 X:3705143-3705165 GTAGCCTCCAGGACTGACAGCGG - Intronic
1186222680 X:7366427-7366449 TAGGCCTTCAGGCCTGGGATGGG - Intergenic
1186324036 X:8459213-8459235 GGGGCCTCCAGGCCTGTGAAGGG + Intergenic
1186372919 X:8965565-8965587 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1186700251 X:12083138-12083160 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1186742567 X:12534004-12534026 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1187072402 X:15901255-15901277 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1187574716 X:20542271-20542293 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1187615818 X:20991992-20992014 TAGGCTTCCAGGTCTGTGATGGG + Intergenic
1187643448 X:21319538-21319560 TAGGCCTCTGGGACTGTGATGGG + Intergenic
1188056085 X:25542310-25542332 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1188115025 X:26232140-26232162 TAGGCCTCCAGATCTGTGATGGG + Intergenic
1188115640 X:26239103-26239125 TAGGCCTCCAGGCCTGTGACAGG + Intergenic
1188155512 X:26737001-26737023 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1188259754 X:28008474-28008496 TAGGCCTCCAGACCTGTGATGGG + Intergenic
1188449530 X:30294811-30294833 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1188753872 X:33936335-33936357 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1188781761 X:34294782-34294804 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1188865134 X:35305222-35305244 TAGGCCTCTAGGCCTGTGATAGG - Intergenic
1188926477 X:36050786-36050808 TAGGCATCCAGGCCTGTGATGGG - Intronic
1189017131 X:37295962-37295984 CAGGCCTCCAGGCCTGTGATAGG + Intergenic
1189025404 X:37388679-37388701 TAGGCCTCCAGGCCTGTGATAGG + Intronic
1189071347 X:37866877-37866899 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1189213332 X:39302969-39302991 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1189253773 X:39621495-39621517 TAGGCCTCCAGGCTTGTGATAGG + Intergenic
1189656436 X:43249623-43249645 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1190269715 X:48853098-48853120 TAGGCATCCAGGCCTGTGATGGG + Intergenic
1190513332 X:51195906-51195928 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1190950568 X:55139477-55139499 TAGGCCTTCAGGCCTGTGATGGG - Intronic
1191052337 X:56207153-56207175 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1191116465 X:56857985-56858007 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1191229895 X:58085583-58085605 GAGGCCTCCCGGACTGACTCTGG - Intergenic
1191679995 X:63831161-63831183 CAGGCCTAAAGGACTGTGATAGG - Intergenic
1192132667 X:68567526-68567548 TAGGCCTCCAGGCCTGTGAGGGG + Intergenic
1192309384 X:69997659-69997681 TAGGCCTCCAGGCCTGTGATGGG - Intronic
1192335580 X:70216765-70216787 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1192362198 X:70447037-70447059 AAGGCCTCCAGGACAGAGAGGGG - Intronic
1192378268 X:70587311-70587333 TAGGCCTCCAGACCTGTGATGGG - Intronic
1192527788 X:71862342-71862364 TGGGCCTCCAGGCCTGGGATGGG + Intergenic
1192565386 X:72158989-72159011 TAGGCCTCCAGGCATGTGATGGG + Intergenic
1192841888 X:74865623-74865645 TAGGCCTCCAGGCCTTTGATGGG - Intronic
1192856583 X:75018439-75018461 TAGGCCTCCGGGCCTGTGATGGG + Intergenic
1193008091 X:76643753-76643775 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1193188336 X:78539338-78539360 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1193221269 X:78929300-78929322 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1193250244 X:79281993-79282015 TATGCCTCCAGGGCTGTGATGGG + Intergenic
1193406395 X:81107196-81107218 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1193506272 X:82348329-82348351 TAGTCCTCCAGGCCTGTGATGGG + Intergenic
1193519640 X:82512600-82512622 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1193520104 X:82519069-82519091 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1193529895 X:82643418-82643440 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1193686191 X:84579961-84579983 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1193707920 X:84845127-84845149 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
1193711297 X:84883799-84883821 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1193759227 X:85443469-85443491 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1193796895 X:85888133-85888155 TAGGCCTCCAGGCATGTGATGGG - Intronic
1193807959 X:86016378-86016400 TAGGCCTGCAGGCCTGTGATGGG - Intronic
1193813781 X:86082196-86082218 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1193845670 X:86466956-86466978 TAGGCCTCCAAGCCTGTGATGGG + Intronic
1193850452 X:86531348-86531370 TATGCCTCCAGGTCTGTGATGGG - Intronic
1193938536 X:87652210-87652232 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1194014237 X:88599393-88599415 TAGGCCTCCAGGCTTGTGATGGG + Intergenic
1194043375 X:88970822-88970844 CAGGCCTTCAGGCCTGTGATGGG + Intergenic
1194082951 X:89490408-89490430 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1194084218 X:89505964-89505986 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1194145358 X:90255089-90255111 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1194149849 X:90310139-90310161 TAGGCCTCCATGCCTGTGATGGG + Intergenic
1194216354 X:91134594-91134616 TAGGCCGCCAGGCCTGTGATGGG - Intergenic
1194244436 X:91493647-91493669 TAGGCCTCCAGGGCTGTGATGGG + Intergenic
1194254014 X:91613923-91613945 TAGGACTCCAGGCCTGTGATGGG + Intergenic
1194320564 X:92441382-92441404 TAGGCCTCCAGGCTTGTGATAGG - Intronic
1194389576 X:93299861-93299883 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1194522436 X:94935686-94935708 TATGCCTCCAGGCCTGTGATGGG - Intergenic
1194534296 X:95086318-95086340 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1194563150 X:95447600-95447622 CAGGCCTCCAGGCATGTGATGGG + Intergenic
1194578518 X:95642177-95642199 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1194603770 X:95957011-95957033 TAGGCTTCCAGGCCTGTGATGGG - Intergenic
1194688744 X:96956347-96956369 TAGGCCTCCAGGCCTGTGATAGG + Intronic
1194876919 X:99201038-99201060 TTGGCCTCCAGGACTGTGATGGG - Intergenic
1194929374 X:99867712-99867734 TAGGCCTCCAGAACTCTGATGGG - Intergenic
1195210130 X:102646369-102646391 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1195228089 X:102818488-102818510 TGGGCCTCCAGGCCTGTGATGGG + Intergenic
1195608405 X:106835421-106835443 TAGGCTTCCAGGCCTGTGATGGG + Intronic
1195617862 X:106927339-106927361 AAGGGTTCCAGGACTGAGAGGGG - Intronic
1195814260 X:108867947-108867969 TAGACCTCCAGGTCTGTGATGGG + Intergenic
1195816731 X:108896511-108896533 TAGGCCTCCAGGCCTGTAATGGG - Intergenic
1195819729 X:108930991-108931013 TAGGCATCCAGGCCTGTGATGGG - Intergenic
1195863666 X:109407587-109407609 TGGGCCTCCAGGCCTGTGATGGG - Intronic
1196012664 X:110904967-110904989 TAGGTCTCCAGGCCTGTGATGGG + Intergenic
1196173603 X:112616743-112616765 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1196278513 X:113796545-113796567 TAGGCCCCCAGGCCTGTGATGGG - Intergenic
1196390689 X:115204269-115204291 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1196483578 X:116179631-116179653 TAGGCCTCCGGGCCTGTGATGGG - Intergenic
1196512825 X:116532356-116532378 CTGGCCTCCAGGTCTGCGATGGG + Intergenic
1196522158 X:116686942-116686964 TAGGCTTCCAGGTCTGTGATGGG - Intergenic
1196605689 X:117654717-117654739 TAGGCCTCCAGGGCTGTGATGGG + Intergenic
1196903576 X:120410166-120410188 TAGGCCTCCAGGCCTGTGATAGG + Intergenic
1196973914 X:121138168-121138190 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1197016606 X:121632831-121632853 TAGGCCTTCAGGCCTGTGATGGG + Intergenic
1197061356 X:122185001-122185023 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1197092520 X:122556033-122556055 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1197109604 X:122756715-122756737 TAGGCCTCCTGGACTGTGATGGG + Intergenic
1197223090 X:123932205-123932227 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1197375293 X:125675452-125675474 TAGGCCTCTAGGCCTGTGATTGG + Intergenic
1197442883 X:126512163-126512185 TAGGCCTCCAGACCTGTGATGGG + Intergenic
1197527067 X:127576543-127576565 TAGTCCTCCAGGCCTGTGATTGG + Intergenic
1197560573 X:128015221-128015243 TAGGCCTCCAGTCCTGTGATGGG + Intergenic
1197569470 X:128131518-128131540 TAGGCCTCTGGGACTGTGATGGG - Intergenic
1197581855 X:128294054-128294076 TAGGCCTCTGGGCCTGAGATAGG - Intergenic
1197594427 X:128449356-128449378 TAGGCCACCAGGCCTGTGATAGG + Intergenic
1197639792 X:128954900-128954922 TATGCCTCCAGGCCTGTGATGGG + Intergenic
1197642846 X:128985952-128985974 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1198274625 X:135089275-135089297 TAGGCCTCCAGGCCTATGATGGG - Intergenic
1198566016 X:137906531-137906553 TAGGCCTCCAGTCCTGTGATGGG - Intergenic
1198693258 X:139307449-139307471 TAGGCCTCCAGGTCTGTGATGGG - Intergenic
1198910344 X:141606823-141606845 GAGGTCACCAGGAATGTGATGGG - Intronic
1198919399 X:141708558-141708580 TAGGCCTCCAGGTCTGTGTTGGG + Intergenic
1198956214 X:142134698-142134720 TAGGCCTCCAGGTCTGTAATGGG - Intergenic
1199070444 X:143469344-143469366 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1199071122 X:143476825-143476847 TAGGCCTTCAGGTCTGTGATAGG - Intergenic
1199077920 X:143545299-143545321 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1199106539 X:143875585-143875607 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1199112087 X:143947057-143947079 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1199117441 X:144008897-144008919 TAGGCCTCCAGGGCTGTGATGGG + Intergenic
1199127391 X:144139033-144139055 TAGGCCTCCAGGCCTGTAATGGG + Intergenic
1199200836 X:145087551-145087573 TAGGCCTCCAGACCTGTGATGGG - Intergenic
1199346539 X:146747153-146747175 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1199370447 X:147042107-147042129 TAGGCTTCCAGGTCTGTGATGGG - Intergenic
1199389366 X:147261990-147262012 TAGGCCTCCAGGCCTGTGATGGG - Intergenic
1199393494 X:147307978-147308000 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1199458755 X:148059601-148059623 TAGGCCTTCAGGCCTGTGATAGG + Intergenic
1199462608 X:148101030-148101052 TGGGCCTCCAGGCCTGTGATGGG - Intergenic
1199515303 X:148668754-148668776 TAGGCCTCCTGGCCTGTGATGGG + Intronic
1199560709 X:149159727-149159749 TAGGCTTCCAGGTCTGTGATGGG + Intergenic
1199622977 X:149715530-149715552 GGAGGCTCCAGGACTGAGGTAGG - Intronic
1199639053 X:149842117-149842139 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1199806540 X:151305857-151305879 TAGGCCTCCAAGCCTGTGATGGG + Intergenic
1199929820 X:152506751-152506773 TAGGCCTCCAGACCTGTGATGGG + Intergenic
1200039971 X:153358045-153358067 TAGCCCTCCAGGCCTGTGATGGG - Intronic
1200067849 X:153513079-153513101 CTGGCCTCCAGGACTGGGAGAGG - Intergenic
1200113541 X:153757920-153757942 GTGGCCGCCAGGACTGGGGTAGG + Intergenic
1200295415 X:154914266-154914288 TAGGCCTCCAGGCCTGTGATGGG + Intronic
1200380676 X:155834395-155834417 TAGGTCTCCAGGCCTGTGATGGG - Intergenic
1200435602 Y:3146281-3146303 TAGGCCTCCAGGCCTGTGATGGG + Intergenic
1200436859 Y:3161850-3161872 TAGGCCTCCAGGCCTGTGATTGG + Intergenic
1200491120 Y:3824387-3824409 TAGGCCTCCAGGTCTGTGATGGG + Intergenic
1200563414 Y:4734944-4734966 TAGGCCTCCAGGGCTGTGATGGG + Intergenic
1200572800 Y:4853500-4853522 TAGGACTCCAGGCCTGTGATGGG + Intergenic
1201402256 Y:13615805-13615827 GAGGCCTGCAGCATTAAGATGGG + Intergenic