ID: 1021530506

View in Genome Browser
Species Human (GRCh38)
Location 7:21639389-21639411
Sequence CAGCTTTCCTAGGGGAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021530496_1021530506 21 Left 1021530496 7:21639345-21639367 CCAGAATTCTGGGACAAGAACTG 0: 1
1: 0
2: 1
3: 15
4: 178
Right 1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG No data
1021530493_1021530506 24 Left 1021530493 7:21639342-21639364 CCCCCAGAATTCTGGGACAAGAA 0: 1
1: 0
2: 5
3: 90
4: 950
Right 1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG No data
1021530492_1021530506 30 Left 1021530492 7:21639336-21639358 CCAAATCCCCCAGAATTCTGGGA 0: 1
1: 0
2: 4
3: 21
4: 302
Right 1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG No data
1021530494_1021530506 23 Left 1021530494 7:21639343-21639365 CCCCAGAATTCTGGGACAAGAAC 0: 1
1: 0
2: 0
3: 17
4: 237
Right 1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG No data
1021530495_1021530506 22 Left 1021530495 7:21639344-21639366 CCCAGAATTCTGGGACAAGAACT 0: 1
1: 0
2: 1
3: 17
4: 213
Right 1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG No data
1021530500_1021530506 -8 Left 1021530500 7:21639374-21639396 CCATTGCCTGGTTAGCAGCTTTC 0: 1
1: 0
2: 0
3: 7
4: 145
Right 1021530506 7:21639389-21639411 CAGCTTTCCTAGGGGAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021530506 Original CRISPR CAGCTTTCCTAGGGGAGAAA GGG Intronic
No off target data available for this crispr