ID: 1021531126

View in Genome Browser
Species Human (GRCh38)
Location 7:21646636-21646658
Sequence GGTGCCCAGTGAGCTCCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021531125_1021531126 -4 Left 1021531125 7:21646617-21646639 CCTGGGGAAAGAACTATCAGGTG 0: 1
1: 0
2: 1
3: 13
4: 100
Right 1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG No data
1021531123_1021531126 1 Left 1021531123 7:21646612-21646634 CCAGGCCTGGGGAAAGAACTATC 0: 1
1: 0
2: 2
3: 20
4: 177
Right 1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG No data
1021531122_1021531126 2 Left 1021531122 7:21646611-21646633 CCCAGGCCTGGGGAAAGAACTAT 0: 1
1: 0
2: 1
3: 17
4: 234
Right 1021531126 7:21646636-21646658 GGTGCCCAGTGAGCTCCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021531126 Original CRISPR GGTGCCCAGTGAGCTCCAGC AGG Intronic
No off target data available for this crispr