ID: 1021539489

View in Genome Browser
Species Human (GRCh38)
Location 7:21741650-21741672
Sequence CTGCAGGCCCTAAAGTATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 93}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021539489_1021539493 -2 Left 1021539489 7:21741650-21741672 CCCTCATACTTTAGGGCCTGCAG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1021539493 7:21741671-21741693 AGAGTTTATGGCAAAGTCAGAGG No data
1021539489_1021539494 13 Left 1021539489 7:21741650-21741672 CCCTCATACTTTAGGGCCTGCAG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1021539494 7:21741686-21741708 GTCAGAGGCTTAACAAAGTAAGG 0: 1
1: 0
2: 4
3: 10
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021539489 Original CRISPR CTGCAGGCCCTAAAGTATGA GGG (reversed) Intronic
900956826 1:5891476-5891498 CTCCTGGCCCTAAAGCAGGACGG + Intronic
904974184 1:34443138-34443160 CTGCAGCCCCTCAAGTCAGATGG - Intergenic
908406520 1:63819330-63819352 CTGCAGGCACTGACTTATGAGGG + Intronic
909587680 1:77309054-77309076 CTGCAGGCCCCAGTGTATGCTGG - Intronic
913113262 1:115674783-115674805 TTGCAGGCCATAAAGTGTGAGGG + Intronic
914721664 1:150294321-150294343 CTGTAGAGCCTAAAGGATGATGG - Exonic
919816498 1:201444026-201444048 CAGCAGGCTCTAGAGGATGATGG + Intergenic
920244172 1:204575627-204575649 CTGAAGTCCCTGAAGAATGAGGG + Intergenic
923037441 1:230294126-230294148 CTGCAGGCCAGAAAGAAAGAAGG + Intergenic
1066655078 10:37690673-37690695 CTGCAGACCCTGAAGACTGAAGG + Intergenic
1067040129 10:42946764-42946786 CTGCAGACCCTGAAGACTGAAGG + Intergenic
1067438993 10:46297727-46297749 CTGCTGCCCCCAAAGCATGAGGG + Intronic
1070622854 10:78027312-78027334 ATGCAGGAGCTAAAGCATGAGGG + Intronic
1078549303 11:12269455-12269477 CTGCAGGCTCCAGAGTATCAGGG - Intergenic
1083074934 11:60027207-60027229 CTACAGCTCCTAAAGTAGGATGG + Intergenic
1084927319 11:72523821-72523843 CTTCAGGCCACAAAGAATGACGG - Intergenic
1088230652 11:107670450-107670472 CTGGAGGCCCTAAGGTCTGTGGG + Intergenic
1088847786 11:113682330-113682352 CTGCAGGCCCTGAGGAAGGAGGG + Intergenic
1089451627 11:118602078-118602100 CTGTTGGCCCTAAACTATCAAGG + Exonic
1091475892 12:771938-771960 CTGCAGTCCTTAAATTAAGAGGG - Intronic
1095990138 12:48028889-48028911 CTGCCTGCCCTCAAGAATGAGGG + Intergenic
1097104010 12:56609938-56609960 CTGCAAGCCCTAAGGTAGCAAGG + Exonic
1100567681 12:95813649-95813671 CTTCAGGCTCTGAAGTAGGAAGG - Intronic
1103960005 12:124603487-124603509 CAGCAGGCCCCAGAGGATGAGGG + Intergenic
1104473642 12:129052277-129052299 CTGTAGGCCCCATAGTATAAAGG - Intergenic
1107098622 13:36563049-36563071 ATACGGGCCCTCAAGTATGAAGG - Intergenic
1116172811 14:41424925-41424947 CTGCAGGGCCTAAGGTAAGCAGG + Intergenic
1119378790 14:74215577-74215599 CTGCAGGGCCTAAAGCAAGGGGG + Intergenic
1133013695 16:2929261-2929283 CTCCAGTCCCTACATTATGACGG - Intronic
1140025480 16:71286465-71286487 CTGAAGGAGGTAAAGTATGACGG - Intronic
1140508767 16:75492311-75492333 CTGGAGGCCATAAAGTCTGAGGG + Intronic
1141427629 16:83953986-83954008 CTGGGGGCGCTAAAGTGTGAGGG - Intronic
1153700094 18:7683998-7684020 CTGCAGGCCCTGAAGAGGGAGGG - Intronic
1156748508 18:40421517-40421539 CTGCAGGCCCTGAAGGCTCATGG - Intergenic
1164954720 19:32372508-32372530 CTGCAGGCCGAAAAGTTTGAGGG + Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
926327052 2:11794185-11794207 CTAGAGGCCTTAAAGCATGAAGG + Intronic
927525004 2:23731383-23731405 CTGCAGGCTCTAATGTATTTAGG + Intergenic
931159944 2:59678026-59678048 ATGCAGGGCCTAAAGTGAGACGG + Intergenic
935943723 2:108267963-108267985 CTGGAGGCACTAAGGTCTGATGG - Intergenic
937228285 2:120382282-120382304 CTGCAGGCCCCAAAGCAGAAGGG - Intergenic
940856051 2:158729541-158729563 CTGCAGTCCATAAAGCAAGATGG + Intergenic
948271129 2:236674054-236674076 CTCCAGGCCCCAAAGCATGGAGG - Intergenic
1172409558 20:34711166-34711188 CTGCAGGCCCTGAAATCTGAAGG + Exonic
1175844630 20:62051949-62051971 CTGCAGGCCCTAGAGCCTGGTGG - Intronic
1176107587 20:63396650-63396672 CTCCAGGCCATGAAGGATGAGGG + Intergenic
1178194514 21:30328330-30328352 CTGCATTCCCGAAACTATGACGG + Intergenic
1179109381 21:38433280-38433302 CTGCAGGCCCAAAAAGATGGAGG + Intronic
950134048 3:10568141-10568163 CTGCAGGACCTACAGTGTCAGGG - Intronic
950805535 3:15600219-15600241 CTCCAGGCACTCATGTATGATGG + Intronic
950865883 3:16188747-16188769 CTTCAGGCACTAAGGAATGAGGG - Intronic
951643935 3:24866637-24866659 CTGCAGGCCTCACAGTATGTGGG + Intergenic
954102089 3:48381431-48381453 ACCCAGGCCCTAAAATATGATGG - Intronic
954448384 3:50558761-50558783 CTGCAGTCCCTGAAGATTGAAGG + Exonic
955236500 3:57144241-57144263 TAACAGGCCCTAGAGTATGAGGG - Intronic
956128913 3:66037062-66037084 CTGCAGAGCCTTAAGTATGGAGG - Intronic
966429912 3:179820545-179820567 CTGCTGGTGCTAAAGAATGAGGG + Intronic
968503317 4:961040-961062 CTGCTGGCCCTAAGGTATGTGGG - Exonic
971201040 4:24509370-24509392 CAGCAGGCCCTGAAGACTGAAGG - Intergenic
974603820 4:64122933-64122955 CTGCAGGTCCTGAACTATGCAGG - Intergenic
975361655 4:73477488-73477510 CTGCAGGACCTAAACTATAGAGG - Intergenic
985650873 5:1106822-1106844 CTGTGGGTCCTAAAATATGAGGG - Intronic
995840479 5:116439079-116439101 TTGCAGCCCCTAAAGTGTCAGGG + Intergenic
996252881 5:121359112-121359134 CTACAGGCACTCAAGTAAGAGGG - Intergenic
1001219528 5:169888241-169888263 CTGGAGGCCCTTAAGTCTTATGG + Intronic
1002382220 5:178839142-178839164 CTGGAGGCCCTGAAGTAGCAAGG + Intergenic
1002964560 6:1950543-1950565 CTCCAGGGCCTTAAGTATTATGG - Intronic
1004340545 6:14804109-14804131 CTCCAAGCCCTAAGGCATGAGGG + Intergenic
1005364665 6:25064858-25064880 CTGCAACCCCAAAAGGATGATGG - Intergenic
1007815780 6:44524674-44524696 CAGCAGGCCTTAAAGGATTATGG + Intergenic
1009949427 6:70378829-70378851 CTGCAGGCCCCAAAGCAAGTGGG + Intergenic
1010144983 6:72658029-72658051 CTGCAGGCCAGGAAGTATGATGG + Intronic
1010510333 6:76710441-76710463 TTGCATGCCATAAAGTATAAAGG - Intergenic
1021539489 7:21741650-21741672 CTGCAGGCCCTAAAGTATGAGGG - Intronic
1022665989 7:32410833-32410855 CTTCAGGCCCACAAGTGTGATGG + Intergenic
1022953659 7:35362359-35362381 GTCTAGGCACTAAAGTATGATGG - Intergenic
1023043379 7:36191917-36191939 CTACATGCCCTTAAGTTTGAAGG + Intronic
1028667771 7:93366556-93366578 CTGCAGGCACTAAAAATTGAAGG - Intergenic
1031994943 7:128224027-128224049 CTGCAGGGCCCAAAGCAGGATGG + Intergenic
1033232860 7:139615117-139615139 TTGCAGGCCCTAAAGGACTATGG + Intronic
1033431484 7:141293500-141293522 CTGCAGGCCCCTAATGATGAGGG + Intronic
1034468361 7:151242949-151242971 CTACATGCCCAAAAGTAGGATGG - Intronic
1035732985 8:1865625-1865647 CTGCAGGACCTTGAGGATGAGGG - Intronic
1036997171 8:13671387-13671409 TCCCAGGCCCTAAAGAATGAGGG - Intergenic
1037310537 8:17551044-17551066 CGGTAGGCCCTTAAGTATCAAGG - Intronic
1038665509 8:29534132-29534154 CTACATGGCCTAAAGTATGAGGG - Intergenic
1039671122 8:39600209-39600231 CTGCAGGCCACAAAGTTTTATGG + Intronic
1041830047 8:62143748-62143770 CTGCAGTACATAAAGTGTGATGG - Intergenic
1043150541 8:76709352-76709374 GTGCAGGCCCTAATGTGAGATGG + Intronic
1044236413 8:89836044-89836066 CTCCACATCCTAAAGTATGATGG + Intergenic
1048399626 8:134052178-134052200 CTGCAGGCAATTAAGTCTGAGGG - Intergenic
1051558073 9:18407314-18407336 GTGCAGACCCAAAAGCATGAGGG + Intergenic
1053172182 9:35896034-35896056 CTTCTGGCCCCAAAGGATGATGG - Intergenic
1059336528 9:113572559-113572581 CTGCAGGCCCTGAAGGAGGAGGG + Intronic
1060250158 9:121979928-121979950 CTTCAGGCAGAAAAGTATGAAGG - Intronic
1061356907 9:130112643-130112665 CTGCTGGGCCTGAAGTGTGATGG + Intronic
1062256731 9:135626730-135626752 CTGGTGGGCCTAAAGCATGAGGG - Intronic
1195006536 X:100690839-100690861 CTGCTGTCCCTTAAGAATGAGGG - Intronic
1197775794 X:130117989-130118011 CTGCAGGCCCTTGAGTGTGCTGG + Intergenic
1199141489 X:144318989-144319011 CTGCAAGTCCAAAAATATGAAGG + Intergenic
1199696427 X:150345843-150345865 CTGCAGGCCCTGTATTCTGATGG - Intergenic
1199976713 X:152898567-152898589 CTGCAGGCCTTTAAGAATCAGGG + Intergenic