ID: 1021539634

View in Genome Browser
Species Human (GRCh38)
Location 7:21742942-21742964
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 791
Summary {0: 3, 1: 35, 2: 100, 3: 191, 4: 462}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021539634_1021539643 26 Left 1021539634 7:21742942-21742964 CCTGGTCTCTGCTTCCAAAATGG 0: 3
1: 35
2: 100
3: 191
4: 462
Right 1021539643 7:21742991-21743013 GCAGAAAGGACAGAGCAAATCGG 0: 1
1: 0
2: 5
3: 55
4: 461
1021539634_1021539639 3 Left 1021539634 7:21742942-21742964 CCTGGTCTCTGCTTCCAAAATGG 0: 3
1: 35
2: 100
3: 191
4: 462
Right 1021539639 7:21742968-21742990 CTTAAGTGGTGCATCCTCACAGG No data
1021539634_1021539640 4 Left 1021539634 7:21742942-21742964 CCTGGTCTCTGCTTCCAAAATGG 0: 3
1: 35
2: 100
3: 191
4: 462
Right 1021539640 7:21742969-21742991 TTAAGTGGTGCATCCTCACAGGG 0: 1
1: 0
2: 1
3: 9
4: 164
1021539634_1021539644 27 Left 1021539634 7:21742942-21742964 CCTGGTCTCTGCTTCCAAAATGG 0: 3
1: 35
2: 100
3: 191
4: 462
Right 1021539644 7:21742992-21743014 CAGAAAGGACAGAGCAAATCGGG 0: 1
1: 0
2: 2
3: 23
4: 345
1021539634_1021539641 12 Left 1021539634 7:21742942-21742964 CCTGGTCTCTGCTTCCAAAATGG 0: 3
1: 35
2: 100
3: 191
4: 462
Right 1021539641 7:21742977-21742999 TGCATCCTCACAGGGCAGAAAGG 0: 2
1: 34
2: 90
3: 471
4: 1249

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021539634 Original CRISPR CCATTTTGGAAGCAGAGACC AGG (reversed) Intronic
900339969 1:2183672-2183694 CCATCTTGGAAGCAGAGATCAGG - Intronic
900627467 1:3615546-3615568 CCACTTAGGAAGTACAGACCCGG + Intergenic
900637951 1:3675008-3675030 CCATTGTGGGAGGAGACACCTGG - Intronic
900637958 1:3675032-3675054 CCATTGTGGGAGGAGACACCTGG - Intronic
900637965 1:3675056-3675078 CCATTGTGGGAGGAGACACCTGG - Intronic
900637972 1:3675080-3675102 CCATTGTGGGAGGAGACACCTGG - Intronic
900637979 1:3675104-3675126 CCATTGTGGGAGGAGACACCTGG - Intronic
900637986 1:3675128-3675150 CCATTGTGGGAGGAGACACCTGG - Intronic
900637993 1:3675152-3675174 CCATTGTGGGAGGAGACACCTGG - Intronic
900638000 1:3675176-3675198 CCATTGTGGGAGGAGACACCTGG - Intronic
900638007 1:3675200-3675222 CCATTGTGGGAGGAGACACCTGG - Intronic
900638014 1:3675224-3675246 CCATTGTGGGAGGAGACACCTGG - Intronic
900638021 1:3675248-3675270 CCATTGTGGGAGGAGACACCTGG - Intronic
900638028 1:3675272-3675294 CCATTGTGGGAGGAGACACCTGG - Intronic
900638035 1:3675296-3675318 CCATTGTGGGAGGAGACACCTGG - Intronic
900638042 1:3675320-3675342 CCATTGTGGGAGGAGACACCTGG - Intronic
901021111 1:6256246-6256268 CCATCTTTGAAGCACAGACCAGG + Intronic
901593011 1:10361936-10361958 CCATTTTGGTAACTGACACCTGG + Intronic
902537120 1:17125949-17125971 CCATCTTGGAAGCAGGGAGGCGG + Intergenic
902966905 1:20011838-20011860 CCATCTTGGTAGCAGAGACCAGG - Intergenic
902967165 1:20013994-20014016 CCATCTTAGAAGCAAAGACCAGG - Intergenic
903050665 1:20598346-20598368 CCATCTTGGAAGCTGAGACTGGG + Intronic
903394155 1:22986483-22986505 CCATCTTGAAAGCAGACACCGGG + Intergenic
903406033 1:23097059-23097081 TCATCTTGGAAGCAGAGACTGGG - Intronic
903629600 1:24757393-24757415 TTATTTTGGAAGTAGAGAACAGG + Intronic
903691792 1:25179350-25179372 CCCTTTGGTAAGCAGAGAACTGG + Intergenic
904148228 1:28413097-28413119 CCTTTTTGGCACCAGGGACCAGG - Intronic
904275359 1:29380317-29380339 CCATTTTGGAACCAGAAGCCTGG + Intergenic
905000459 1:34664104-34664126 CCATCTTAGAAGCAGAGACCAGG + Intergenic
905020370 1:34806815-34806837 TCATCTTGGAAGCAGAGACTAGG - Intronic
905020772 1:34809787-34809809 CCATCTTGAAAGCAGAGACAGGG - Intronic
905710027 1:40094209-40094231 CCTTTTTGGCACCAGGGACCAGG + Intronic
906854854 1:49293009-49293031 CCCTTTGGGAAGCCCAGACCTGG + Intronic
907262822 1:53234195-53234217 CAGTTGTGGAAGCAGAGACTGGG + Intronic
907761394 1:57364389-57364411 CCATACTGGAACAAGAGACCTGG + Intronic
907855057 1:58295146-58295168 ACATTTTGGAGGAGGAGACCAGG - Intronic
908171177 1:61506127-61506149 CCATATTGAAAGCAGAGTCCAGG + Intergenic
908499479 1:64728943-64728965 CCATCTTAGAAGCAGAGAGCAGG + Intergenic
908669222 1:66527519-66527541 CCATCTTGGAAGCAGAGACTAGG + Intergenic
909268391 1:73591758-73591780 CCAACTTGGAAGCAGAGACCAGG + Intergenic
909717296 1:78724840-78724862 TCATGTCGGAAGCAGAGAACAGG + Intergenic
909983944 1:82137307-82137329 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
910218831 1:84868746-84868768 CCCTTCTGGAAGCAGAGACCAGG + Intronic
911024560 1:93423262-93423284 CTATTTTGGAAGCAGAGATCTGG + Intergenic
911099926 1:94087531-94087553 CCATGTTGCAGGCAGGGACCAGG - Intronic
911164346 1:94711870-94711892 CCATTTTGGAAGCAGAGACTGGG - Intergenic
911201255 1:95046521-95046543 CCTTTTTGGCACCAGGGACCAGG - Intronic
911317707 1:96375467-96375489 CCATCTTTGAAGCAGAGACTAGG + Intergenic
911844187 1:102728476-102728498 CCACCTTGGAAGTACAGACCAGG + Intergenic
912138100 1:106685728-106685750 CCATCTTGGAAGCAGAGACCAGG + Intergenic
913183927 1:116349561-116349583 CCAACTTGAAAGCAAAGACCAGG - Intergenic
913218806 1:116643249-116643271 TGATTTGGGAATCAGAGACCTGG - Intronic
915275777 1:154787311-154787333 CCATTTGGGAGGGAGGGACCAGG + Intronic
915887682 1:159740766-159740788 CCATCTTGGAGGTAGAGACTGGG - Intergenic
915934306 1:160081789-160081811 ATTTTTTGGAAGGAGAGACCTGG - Intronic
916543930 1:165784367-165784389 TCATTATGGAAGCAGGGAGCTGG - Intronic
917286202 1:173423934-173423956 CCTCCTTGGAAGCAGAGACCAGG - Intergenic
918334209 1:183491851-183491873 CCATCTTGGAAGCAGAGACTGGG - Intronic
918425363 1:184404426-184404448 CCATCTTGGAAGCCAAGACTGGG - Intronic
919001025 1:191831704-191831726 TCATCTTGGAAGGAGAGACTGGG - Intergenic
919159113 1:193805715-193805737 CCATCTTGGAAGCAGAGATTGGG - Intergenic
919349699 1:196433120-196433142 CCATCTTGAAAGCAGAGAGAAGG + Intronic
919536935 1:198798641-198798663 CATTCTTGAAAGCAGAGACCAGG + Intergenic
919628103 1:199932253-199932275 CCTTCTTGGAAGCAGAGAGATGG + Intergenic
919703059 1:200651473-200651495 CCATCTTTGAAGTAGAGAGCAGG + Intronic
920000047 1:202790821-202790843 CCATCTTGAAAGTGGAGACCAGG + Intronic
920265896 1:204722457-204722479 TCATCTTGGAAGCAGAGAGCGGG - Intergenic
920954786 1:210608798-210608820 CCATCTTGGAGGGAGAGACTGGG - Intronic
921184345 1:212657012-212657034 GTATTCTGGTAGCAGAGACCTGG + Intergenic
922027402 1:221763646-221763668 CCATCTTGGAAGGAGAGACTGGG - Intergenic
922029045 1:221780505-221780527 CCACCTTGGAAGCAGATCCCAGG + Intergenic
922312587 1:224409686-224409708 TCATTTTTGAAGTAGAGACGGGG - Intronic
922366171 1:224866022-224866044 TCATCTTGGAAGCATAGACTGGG - Intergenic
922441090 1:225655246-225655268 CCATATTGCAAGTAGAGACAGGG + Intergenic
922842877 1:228658474-228658496 ACATCTTGGAAGCAGAGACGGGG + Intergenic
923156142 1:231281131-231281153 CCACTTTAGAAGCAAAGACCAGG - Intergenic
923491210 1:234485680-234485702 CCTTTTTGGCACCAGGGACCAGG - Intergenic
923917883 1:238529697-238529719 CCTTTTGGGAAGCCCAGACCTGG - Intergenic
923967138 1:239154549-239154571 ACAACTTGGAAGCAGAGCCCAGG + Intergenic
924550423 1:245070985-245071007 CCATCTTGGAAGCAGAGACCAGG + Intronic
1062771358 10:104212-104234 CCCTTTGGGAAGCCCAGACCTGG - Intergenic
1062787243 10:275316-275338 CCCCTTAGGAAGCAGAGACTAGG + Exonic
1063719110 10:8560645-8560667 GCATTTTTGAAGCAGGTACCTGG - Intergenic
1065060383 10:21894903-21894925 CCATCTTGGAAACAGAGACCAGG + Intronic
1065074198 10:22060656-22060678 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1065228833 10:23575621-23575643 CCACCTTGGGAGCAGAGATCAGG + Intergenic
1065259077 10:23906004-23906026 CCATTGTGGAATCAGAGACAGGG - Intronic
1065319235 10:24493830-24493852 CAATCTTGGTAGCAGAGACAGGG + Intronic
1065772170 10:29087636-29087658 CCATTTTGGAAGCAGGGAACAGG + Intergenic
1066481023 10:35795534-35795556 CCATTTTGAATGCTGAGACGGGG + Intergenic
1066578216 10:36849957-36849979 TCATCTTAGAAGTAGAGACCTGG + Intergenic
1066733105 10:38451067-38451089 CCATGTGGGAGGCAGAGGCCGGG + Intergenic
1067838554 10:49657199-49657221 CCATCTTGGAAGCACAGAGCAGG - Intronic
1068062668 10:52088627-52088649 CCATCTTGGAAGCAGATGCTGGG + Intronic
1068265635 10:54644938-54644960 CCATCTTTGAAACAGAGGCCAGG + Intronic
1068437765 10:57014691-57014713 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1068766783 10:60773350-60773372 CCATCTTGGAAACAGAGAGCAGG - Intergenic
1069096649 10:64267409-64267431 CCATTTGTGAATCAGAGACCAGG + Intergenic
1069375217 10:67786573-67786595 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1069938423 10:71936297-71936319 CCATCTTGAAAGCATACACCGGG - Intergenic
1070653784 10:78256825-78256847 CCATCCTGGAAGCAAAGCCCCGG - Intergenic
1070655717 10:78269787-78269809 CCATTTAGCAAACAGAGCCCTGG - Intergenic
1071279812 10:84090749-84090771 CCATCTTTGAGGCAGAGATCTGG - Intergenic
1071704943 10:87987866-87987888 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1071830217 10:89364071-89364093 CCTTTTTGAAAGCAGCGATCAGG - Intronic
1071836464 10:89423064-89423086 ACATCTTGGAAGCAGAGACCAGG - Intergenic
1072475532 10:95756423-95756445 CTTTTTAGGAAGCAGAGTCCAGG + Intronic
1072483683 10:95833769-95833791 TCATCTTGGAAGCAGAGACCAGG - Intronic
1072753107 10:97998336-97998358 CAATTTGGGAAGCACAGACCAGG + Intronic
1072877613 10:99189934-99189956 CAGCTTTGGAAGCAGAGACAGGG + Intronic
1073629508 10:105134481-105134503 TTATCTTGGAAGCAGACACCGGG - Intronic
1074140563 10:110668473-110668495 CCAATTTAGAAGCAGCGACTTGG + Intronic
1074577815 10:114686973-114686995 TCATTTTGAAATCAGAGACACGG + Intergenic
1074765356 10:116696099-116696121 CCATCTTAGAAGCAGAGACTGGG + Intronic
1074934646 10:118165902-118165924 CCTTTTTGGCACCAGGGACCAGG - Intergenic
1076322491 10:129593735-129593757 CCTCTTTGGAAGCACAGCCCTGG - Intronic
1076728672 10:132426462-132426484 CCTTTTTGGCACCAGGGACCAGG - Intergenic
1077400092 11:2351054-2351076 CCATCTTGGACGCAGAGATAGGG - Intergenic
1077548890 11:3190669-3190691 CCATTTTGGAAGCAAAGATGGGG - Intergenic
1077719508 11:4613568-4613590 CCATCTTGGAAGCAGGTACCAGG - Intergenic
1077844478 11:6010541-6010563 TCATCTTAAAAGCAGAGACCAGG + Intergenic
1077894641 11:6444530-6444552 CCATCATAGAAGCAGAGACCAGG + Intergenic
1077899178 11:6475987-6476009 TCAGTTTGAAAGCTGAGACCTGG - Exonic
1078964761 11:16325940-16325962 TCGTCTTGGAAGCAGAGACTGGG + Intronic
1079472229 11:20789502-20789524 CCCTTTGGGGAGCACAGACCTGG - Intronic
1079547311 11:21647904-21647926 CCATTTTGGAAATGGAGACAGGG + Intergenic
1079676873 11:23239475-23239497 CCATCTTGGAAACAGAGATTAGG - Intergenic
1080368460 11:31607395-31607417 CCATCTTGGAAGCAGAGTGCTGG - Intronic
1080498735 11:32848143-32848165 CCATCTTGGAAGCAGAGACTGGG - Intronic
1080593034 11:33740082-33740104 CCATCTTTGAAGCAGAGAGTGGG + Intergenic
1081609854 11:44554858-44554880 CCATCTTGGAAGCAAAGAGTGGG + Intergenic
1081848263 11:46256790-46256812 CCATCTTGGAAGCAGAGAGCAGG + Intergenic
1081876060 11:46409182-46409204 CCACTTTGGAAGGAAAGAACTGG + Intronic
1082847921 11:57741382-57741404 CCACTTTGCAAGCAGGGAGCGGG - Intronic
1084194726 11:67517966-67517988 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1084651327 11:70491054-70491076 CCACCTTGGAAGCAGAGTCCTGG + Intronic
1085063659 11:73472127-73472149 CCTTTTTGGCACCAGGGACCAGG - Intronic
1085570074 11:77551433-77551455 TCATATTGGGAGCAGAGACTAGG - Intronic
1085839752 11:79998097-79998119 CCATTTTGAAAGCAGAGACTAGG - Intergenic
1086060264 11:82693093-82693115 CACCTTTGGAAGCAGAGACAAGG - Intergenic
1086060845 11:82698501-82698523 ACATCTTGGAAGCAGAGACCAGG + Intergenic
1086074316 11:82834119-82834141 CCATCTTGAAAGCAGAGACTGGG + Intronic
1086553634 11:88083785-88083807 CTATCTTGGAAGCAGAGAACAGG + Intergenic
1087564229 11:99833930-99833952 TCATTTAGGTAGTAGAGACCAGG + Intronic
1088375238 11:109133580-109133602 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1088416439 11:109594538-109594560 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1088495485 11:110427763-110427785 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1088506321 11:110531231-110531253 CCAGCTGGGAAGCAGAGACTAGG + Intergenic
1088749012 11:112828130-112828152 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1089143840 11:116309910-116309932 TCATCTTGGAAGCAGAGAGGTGG + Intergenic
1089878383 11:121747801-121747823 CCATCTTGAAAGCAGAGACTGGG + Intergenic
1090026838 11:123174893-123174915 GTATTTTGGAAGCAGAGGCAAGG + Intronic
1090374469 11:126279247-126279269 CCATCTTCGAAGCAGAAAGCAGG - Intergenic
1090458948 11:126872723-126872745 CCATTCTGGCAGCACAGAGCAGG - Intronic
1090752797 11:129762276-129762298 CCATTCTGGAAGCTGTGTCCTGG + Intergenic
1090986679 11:131773164-131773186 CCACCTTGGAAGCAGAGACCAGG - Intronic
1091413488 12:259856-259878 CCATTTTTGTAGCAGAGATAGGG + Exonic
1092577623 12:9805283-9805305 TCATCTTGGAAGCAGAGACCAGG - Intergenic
1092765763 12:11851194-11851216 CCATTTTGGAAGGGGAGGCCAGG - Intronic
1092936534 12:13369071-13369093 CCATCTTGGAAACAGAGATCAGG - Intergenic
1093099291 12:15008027-15008049 CCATAGTAGAAGCAGAGACTTGG - Intergenic
1093295274 12:17382043-17382065 CCATCGTGGAAGCGGAGACTTGG + Intergenic
1093376483 12:18434112-18434134 CAATCTCGGAAGCAGAGACTGGG - Intronic
1093480677 12:19601260-19601282 CCATATTGGAATGAGAAACCTGG + Intronic
1094256714 12:28438388-28438410 CCATCTTTGAAGCAGAGAACAGG + Intronic
1094554650 12:31486307-31486329 CCATCTTAGAAGCAGAGACTAGG + Intronic
1094638809 12:32253327-32253349 GCATTTTGAAAGCTGGGACCAGG - Intronic
1094824486 12:34258792-34258814 CCATTTTGGAGACAGTGAACAGG + Intergenic
1095039454 12:37425326-37425348 CCATCTTGGATGCAAAGGCCAGG - Intergenic
1096335197 12:50749938-50749960 CCATTTTGGAAGTAGAGACCAGG + Intergenic
1097119766 12:56722383-56722405 CTATTTTGGAAGAAGAGAATTGG + Intronic
1097399509 12:59112174-59112196 CCATCTTAGAAGCAGAAAGCAGG + Intergenic
1098190888 12:67947066-67947088 CCATCTTAGAAGCAGAGACTAGG + Intergenic
1098290777 12:68955427-68955449 CCCTTTGGGGAGCACAGACCTGG - Intronic
1098904847 12:76151452-76151474 CCTTTTTGAAAATAGAGACCTGG + Intergenic
1098910652 12:76205119-76205141 CCATCTTGGAAACAGAAACTGGG + Intergenic
1098914780 12:76246003-76246025 CCATTCTGGAAGCATAGACAGGG - Intergenic
1099084255 12:78225503-78225525 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1099161432 12:79246554-79246576 CCATCTTAGAAGCAAGGACCAGG - Intronic
1099432500 12:82604614-82604636 CCATCTTGGAAGCAGAGACCTGG + Intergenic
1099705880 12:86152324-86152346 CCATCTTGGAAGCAGAGGTCAGG - Intronic
1100004761 12:89881454-89881476 CCATTTTGGAAGCAGAGACCAGG + Intergenic
1100095331 12:91027069-91027091 CCATCTTGGAAACAAAGACAAGG - Intergenic
1100335383 12:93624191-93624213 CCATCTTGAAAGCAAAGACTAGG + Intergenic
1100794930 12:98171835-98171857 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1100983694 12:100185295-100185317 CCCTTTAGGAAGCAGAGCCAAGG - Intergenic
1101159838 12:101962310-101962332 CCATCCTGGAAGCAGAGACTGGG - Intronic
1101373432 12:104150979-104151001 CCTTTTTGGCACCAGAGACCAGG - Intergenic
1101570531 12:105949271-105949293 CCATCTTGAAAGCACAGACTGGG + Intergenic
1101670431 12:106866533-106866555 GCATTTTGTAAGCCAAGACCAGG - Intronic
1103002307 12:117394562-117394584 CCACTTGGGAGGCTGAGACCTGG - Intronic
1103330682 12:120151758-120151780 CAAGTTTGGAAACAGAGACACGG - Intronic
1104123313 12:125819869-125819891 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1104872767 12:132012368-132012390 CCATCTGGGAAGCGGAAACCAGG - Intronic
1105065454 12:133193486-133193508 TCATCTTGGAAGCACAGAGCAGG - Exonic
1105718996 13:23095329-23095351 CCATCTTGGGAGCAGAAACCAGG + Intergenic
1105968076 13:25402921-25402943 CCATCTTTGAAGCAGACACAGGG - Intronic
1106884504 13:34169444-34169466 CCATCTTGGAAGCAGAGGCTGGG + Intergenic
1107645597 13:42491584-42491606 CCACCTTAGAAGCAGGGACCAGG - Intergenic
1107992121 13:45827849-45827871 CAATTATGGAAGCAGAGAGAAGG - Intronic
1109279743 13:60342156-60342178 CCACCTTGGAAGCAGAGATCGGG + Intergenic
1110006119 13:70272504-70272526 TCATCTTGGAAGCAGAGACCTGG - Intergenic
1110521500 13:76484350-76484372 CCATCTTAGCAGCAGAGACCAGG - Intergenic
1110809056 13:79791596-79791618 CCATTCTGGTATCTGAGACCAGG + Intergenic
1111151355 13:84257303-84257325 GCATTTTAGCAACAGAGACCTGG + Intergenic
1111553468 13:89848417-89848439 CCATATTCGAAGCAGAGACTGGG - Intergenic
1111874699 13:93878724-93878746 TCATCTTGGAAGCAGAGACTGGG + Intronic
1112788444 13:102977512-102977534 CCATTTTGGGAGCAGAGAGTTGG + Intergenic
1112936055 13:104799880-104799902 GAGTTTTGGAATCAGAGACCTGG - Intergenic
1113038697 13:106080789-106080811 CCATTTCTGAAGCAGAGATGGGG - Intergenic
1113674569 13:112198518-112198540 CCATCTTGGAAGCAGAGGCTGGG - Intergenic
1113754164 13:112797987-112798009 CCATCTTGGAAGCAGAGATGGGG - Intronic
1113810080 13:113135440-113135462 CCGTCTTGGAAGCAGAGACCAGG - Intronic
1113869561 13:113550584-113550606 CCATCCCGGAAGCAGAGAGCAGG - Intronic
1114149457 14:20020594-20020616 ACACTTTGGAAACATAGACCAGG + Intergenic
1114192864 14:20453720-20453742 CCATTTTAAAAACAAAGACCAGG + Intronic
1114430991 14:22660438-22660460 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1114584938 14:23802682-23802704 CCATCTTTGAAGCAGAGACCAGG - Intergenic
1114719644 14:24867251-24867273 CTATCTTGGAAGCACAGACTGGG + Intronic
1114956342 14:27824466-27824488 CCATTTTGCAAGCTGAGAAGTGG - Intergenic
1116748522 14:48851723-48851745 CCATCTTGGAAGCAGAAATCAGG + Intergenic
1116940439 14:50785384-50785406 CCATTATGGGGGCAGACACCGGG + Intronic
1117437521 14:55730993-55731015 ACCTTTTGGAAACACAGACCTGG - Intergenic
1117437941 14:55735283-55735305 CCATCTTGGAAACAAACACCAGG - Intergenic
1118111817 14:62730162-62730184 ACAATCTGGAAGCAAAGACCTGG - Intronic
1118996402 14:70840526-70840548 CCATCTTGGAACCAAAGACTGGG - Intergenic
1119080342 14:71686967-71686989 CCAGTTTGGAAGCAGAGAGCAGG + Intronic
1119178275 14:72585838-72585860 CAATATTGGAAGGAGAGAACAGG - Intergenic
1119547636 14:75484016-75484038 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119547644 14:75484064-75484086 CCATCTTGGAAGCAGAGACAGGG - Intergenic
1119915844 14:78401015-78401037 CCATCTTGGAAGCAGGGAACAGG - Intronic
1120169564 14:81235512-81235534 CTATCTTGGAAGCTGAGTCCAGG - Intergenic
1120402979 14:84055651-84055673 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1120609494 14:86622986-86623008 CCATCCTGGAAGCAGAGAGCAGG - Intergenic
1120691951 14:87602543-87602565 CCATATTGGCAGCAGACAGCAGG + Intergenic
1120721341 14:87892625-87892647 CCATCTTGGAGGCAGAGACCAGG - Intronic
1120862581 14:89268222-89268244 CCATTATAGCTGCAGAGACCTGG - Intronic
1121146028 14:91583046-91583068 GCATTCTGGATGGAGAGACCAGG - Intronic
1121456886 14:94044065-94044087 CCAGTGTGGAAGGAGGGACCAGG - Intronic
1121851951 14:97229410-97229432 CCATTTTTGAAGCAGAGAGTGGG - Intergenic
1121954664 14:98203056-98203078 CCACCTTGGAAGTGGAGACCAGG - Intergenic
1122491327 14:102117804-102117826 CCCTTTGGGAAGCCCAGACCTGG + Intronic
1122682371 14:103475532-103475554 TCATGTTGGAAGCAGAGAACAGG - Intronic
1122918503 14:104869758-104869780 CCATCCTTGAAGCAGAGACAGGG + Intronic
1202842193 14_GL000009v2_random:131870-131892 CCCTTTGGGAAGCCCAGACCTGG - Intergenic
1123471502 15:20557550-20557572 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123646501 15:22442805-22442827 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1123731804 15:23152552-23152574 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123749941 15:23349934-23349956 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1123997631 15:25729826-25729848 CCTGTTTGGAAGCAGAGACATGG - Intronic
1124022423 15:25936979-25937001 CCATCTTGGAAGCGGAGACCTGG + Intergenic
1124282309 15:28373830-28373852 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1124300392 15:28537785-28537807 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1125365126 15:38905373-38905395 CCATTTTGGAAGCAAAGTCTGGG - Intergenic
1125423629 15:39528806-39528828 CCACCTTGGAAGCAGAGACTGGG - Intergenic
1126369858 15:47934180-47934202 CCATCTTGGAAGCAGAAGACAGG - Intergenic
1127552126 15:60050808-60050830 CCATCTTGGAATTGGAGACCAGG + Intronic
1127722679 15:61718317-61718339 CCATCTTAGAAGCAGAGTGCGGG + Intergenic
1128220599 15:65965674-65965696 CCATTTTGGAAGCAGAGATTGGG + Intronic
1128300384 15:66563194-66563216 TCATCTTGGAAGCAGAGACTGGG + Intronic
1129380272 15:75160667-75160689 CCATCTTGGAAGCAGAGAGCAGG - Intergenic
1129827571 15:78644473-78644495 CCATCTTGGAAGCAGATACCAGG + Intronic
1130287494 15:82568108-82568130 GAATTTTGTAACCAGAGACCTGG + Intronic
1130401440 15:83558536-83558558 GCCTTTAGCAAGCAGAGACCAGG + Intronic
1130785786 15:87094479-87094501 CCATCTTGAAAGCAGAAACCAGG + Intergenic
1131983344 15:98017221-98017243 CCAATTTGGAGGCTGGGACCTGG - Intergenic
1132248878 15:100318504-100318526 CCATCTGTGAAGCAGAGAGCAGG + Intronic
1132347653 15:101118251-101118273 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1133517678 16:6525649-6525671 CCATCTAGGAAGTAGAGACGGGG - Intronic
1134437026 16:14269034-14269056 CCATCTTCCAAGCAGAGACCTGG - Intergenic
1135290937 16:21237513-21237535 CCATCTTGGAAGCGGAGACAGGG - Intronic
1137009106 16:35306144-35306166 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137022978 16:35448969-35448991 CCATTTTGAGAGAAGAGCCCTGG + Intergenic
1137406703 16:48194750-48194772 CCATCTTGGAAGTAGATACTGGG + Intronic
1138007495 16:53351524-53351546 CCATCTTGGAAGCAAAGACCAGG - Intergenic
1138349781 16:56340317-56340339 CCGAGTTGGAAGCAGACACCAGG - Intronic
1139285591 16:65810776-65810798 CCATCTTGGAAGCAGAGTCCTGG - Intergenic
1139320492 16:66110002-66110024 TCATCTTGGAAGCAGAGACCAGG + Intergenic
1140149571 16:72348605-72348627 CCTTTTTGGCACCAGGGACCAGG + Intergenic
1140241858 16:73209424-73209446 ACATCTTGTAAGCAGTGACCAGG - Intergenic
1140243954 16:73231508-73231530 ACATTTTGGAAGCAGCGAGGGGG + Intergenic
1140463523 16:75160740-75160762 CCATCCTGGAAGAAGAGACCAGG - Intronic
1141917508 16:87109779-87109801 CTATTTTAAAACCAGAGACCAGG - Intronic
1141946096 16:87311036-87311058 CCTTTGTGGGAGCAGAGCCCAGG + Intronic
1142533948 17:600427-600449 GCATTTTGGGAGCAGGGACTAGG - Intronic
1142633923 17:1244898-1244920 CTGTCTTGGAAGCAGAGATCAGG - Intergenic
1143796579 17:9341999-9342021 CCTTTTTGGCACCAGGGACCAGG + Intronic
1144064732 17:11614694-11614716 CCATCTTGGAAGCAGAGGCCAGG - Intronic
1144659326 17:17058248-17058270 CCTCTTTGCAAGCAGGGACCTGG + Intronic
1145378417 17:22373111-22373133 CCATCTTGGATGTAGAGACCAGG + Intergenic
1145754331 17:27379998-27380020 TGATTTTGGAAGCAGAGCTCAGG - Intergenic
1146098115 17:29952098-29952120 CCATCTAGGAAGCAGAGACAAGG - Intronic
1147304557 17:39554281-39554303 CCTTTCTGGAAACAGACACCTGG + Intronic
1148639986 17:49180270-49180292 GCAGTTTGGAAGCAAAAACCAGG + Intergenic
1148972237 17:51493649-51493671 CCATTGTTGAAGCACAGAACAGG - Intergenic
1149062088 17:52434479-52434501 CCATCTTTAAAGCAGAGAGCAGG + Intergenic
1149571577 17:57675965-57675987 CCATTTTGGAAACAGAAAATTGG + Intronic
1150339142 17:64352068-64352090 CCATTTTCAAGACAGAGACCAGG - Intronic
1150473125 17:65454242-65454264 CCATCTTAGAAACAGAGACTAGG + Intergenic
1152156595 17:78637739-78637761 CCACCTTGGAAGCAGAGGCCAGG + Intergenic
1153166812 18:2270992-2271014 ACATCTTAGAAGCACAGACCAGG + Intergenic
1153273013 18:3341889-3341911 CCATCTATGAAGCAGAGAGCAGG - Intergenic
1153431994 18:5027889-5027911 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1153583040 18:6594626-6594648 CCATCTTGAAAGCAGAGAGCAGG - Intergenic
1153833363 18:8942911-8942933 CCATGTTGCCAGCAGAGGCCTGG + Intergenic
1153844259 18:9034128-9034150 CCATCTTGGAGGCAGACAGCAGG + Intergenic
1155921548 18:31608253-31608275 CCATCTTGGAAGCAGACACTGGG + Intergenic
1157633299 18:49122724-49122746 CCTTTTTGGCACCAGGGACCCGG - Intronic
1157786038 18:50483435-50483457 CCATCTTAGAAGCAGAGACCAGG + Intergenic
1159056354 18:63468664-63468686 CATTTTAGGAGGCAGAGACCGGG + Intergenic
1159314704 18:66757127-66757149 GCATCCTGGAAGCAGAGACCTGG + Intergenic
1159332308 18:67012917-67012939 CCATCTTGGAAGTAGAGAGCTGG - Intergenic
1159356714 18:67345709-67345731 CCATTTTGGCACCAGGGACCAGG - Intergenic
1159437878 18:68441888-68441910 GCATTTGGGAAGAAGAGACATGG + Intergenic
1159605018 18:70466126-70466148 CCTTTTTGGTACCAGGGACCAGG - Intergenic
1160669270 19:349284-349306 CCATTTTGGGAGCAGAGACCAGG - Intergenic
1161242646 19:3231017-3231039 TGATTTTGGAAACATAGACCAGG + Intronic
1163478644 19:17541448-17541470 CTAATTTGTAAGCAGAGACTGGG + Intronic
1164613827 19:29652822-29652844 CCATCTTGGAAGCACAGACTGGG - Intergenic
1164672581 19:30081243-30081265 CCATCCTGGAAGCAGAGACTTGG - Intergenic
1165151157 19:33761075-33761097 CCACGTGGGAAGCAGAGACAGGG + Intronic
1165780979 19:38434169-38434191 CCATCTTGGAAGCAGGCACTTGG + Intronic
1167488976 19:49781077-49781099 GCATGGAGGAAGCAGAGACCTGG + Intronic
1167754667 19:51404697-51404719 ACATCTTGGAAGCAGAGATCAGG - Intergenic
1167782511 19:51608301-51608323 CCTTTTGGGAAGGAGAGGCCAGG + Intergenic
1167818126 19:51902101-51902123 CCATATTGAAAGCAGAAATCAGG + Intronic
1168249009 19:55130455-55130477 CCATCTGTGAAGCAGAGAGCAGG - Intergenic
925066379 2:931876-931898 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066396 2:931927-931949 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066413 2:931978-932000 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066429 2:932029-932051 CCATTGCGGAGGCAGAGGCCTGG + Intergenic
925066445 2:932080-932102 CCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066462 2:932131-932153 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066479 2:932182-932204 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066496 2:932233-932255 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066513 2:932284-932306 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066546 2:932386-932408 CCATTGTGGAGGCAGAGGCCTGG + Intergenic
925066563 2:932438-932460 GCATTGTGGAGGCAGAGGCCTGG + Intergenic
925116436 2:1382382-1382404 CCACTATGGAAGCAGAGAGAAGG + Intronic
925751876 2:7096413-7096435 CCATTTAGGAGGCACAGACTGGG + Intergenic
925989758 2:9245169-9245191 TGATTTTGGATGCAGAGAGCTGG + Intronic
927392188 2:22608159-22608181 CAAGTATGGAAACAGAGACCAGG - Intergenic
928152235 2:28842113-28842135 CTAGTTTGGAGTCAGAGACCGGG - Intronic
928448163 2:31351390-31351412 ACATGTTGGAAGCAGAGCTCAGG - Intronic
929027534 2:37619206-37619228 CCATTTGGCAAGCAGTGAGCTGG + Intergenic
929139554 2:38655023-38655045 CCATCTTAGAAGGAGAGACCTGG - Intergenic
929279591 2:40063526-40063548 CCATTTAGGCAGCAGGGACTGGG + Intergenic
929756980 2:44775153-44775175 CCACTTTGGTAGCAGAGAGATGG - Intergenic
929812127 2:45199575-45199597 CCATCTTGGAAGTGGAAACCAGG + Intergenic
929872252 2:45769022-45769044 CCATTTTGGCAGCAGAGCTGTGG + Intronic
930511494 2:52350801-52350823 CCACCTTGGAAGCAGAGATAAGG + Intergenic
930601014 2:53443151-53443173 CCTTTTTGGCACCAGGGACCCGG - Intergenic
930683862 2:54287180-54287202 CCACCTTGGAAGAAGAGATCAGG - Intronic
931115384 2:59161239-59161261 CCATTTTGTAAGCAGAGAGATGG - Intergenic
931409831 2:62018900-62018922 CCCTCTTGGCAGCAGAGACCAGG - Intronic
932272457 2:70422835-70422857 CCATCTTAGAAGCAGAGACCAGG - Intergenic
932368513 2:71168554-71168576 CCATCTTGGAAGCAGAGACCAGG + Intergenic
932484128 2:72071259-72071281 TCATCTTGGAAGCAGAGGCCAGG - Intergenic
932598441 2:73108484-73108506 CCATTTTGGTTGGGGAGACCTGG - Intronic
932652298 2:73571429-73571451 CCATTTTGGAAGCAGAGACTGGG - Intronic
932914637 2:75843480-75843502 CCATCTTGGAAGCAGAGACTGGG - Intergenic
933354405 2:81195523-81195545 CCAACTGGGAAGCAGAGACCAGG - Intergenic
933982392 2:87562377-87562399 CCATTTATGAAGCAGAGAGCAGG - Intergenic
934480936 2:94643519-94643541 CCATTTTGCAAGCTGAGAAATGG + Intergenic
935277036 2:101483986-101484008 CTATCTTGGAAGCAGAGACTGGG + Intergenic
936247995 2:110845188-110845210 CCATCTTGGAAGCAGAGACCAGG - Intronic
936311449 2:111388416-111388438 CCATTTATGAAGCAGAGAGCAGG + Intergenic
936391456 2:112078328-112078350 CCATCTTGGAAGCAGACACCAGG - Intronic
936652902 2:114450034-114450056 CCATTTTGGTAGCACAGCACTGG - Intronic
936870680 2:117131820-117131842 CCACATTGGGAGCAGAGACTAGG - Intergenic
937437033 2:121889287-121889309 CCCTTTGGGAGGCTGAGACCCGG + Intergenic
937480800 2:122256810-122256832 CCATCTTGGATGGAGAGACCAGG + Intergenic
938010759 2:127827095-127827117 CCATTTTGGAAATGGAGAACAGG + Intergenic
940065652 2:149625098-149625120 CCCTTGCTGAAGCAGAGACCAGG + Intergenic
940478715 2:154200564-154200586 CCATCTTGAAAGTGGAGACCAGG - Intronic
941092775 2:161197622-161197644 CCATCTTGGAAACAGAGACTGGG - Intronic
941187185 2:162331612-162331634 CCATCTTGGAAGCAGAGGCTGGG + Intronic
941485617 2:166077131-166077153 CCATTTTGGAACCAGAACTCAGG + Intronic
941693596 2:168527596-168527618 CCATCTTGGAAGCAGAGACTTGG - Intronic
941789343 2:169534347-169534369 CCATCTTGGAAGCAGAGGCTAGG + Intronic
942336483 2:174892428-174892450 CCATCTTGGAAGCACAGTCTGGG + Intronic
942835472 2:180291525-180291547 CAATTTTGGATGCAGACTCCAGG + Intergenic
942875888 2:180797059-180797081 TCATCTTGAAAGGAGAGACCAGG + Intergenic
943677428 2:190729724-190729746 CCCTCTTGGAAGCACAGACAAGG - Intergenic
944509582 2:200451521-200451543 CCATTTTGGAAGCCTGGACTAGG + Intronic
945512494 2:210719928-210719950 TTACTTTGGAAGCAGAGACCGGG - Intergenic
945765352 2:213969591-213969613 CCATCTTGGAAGCAGATACTAGG + Intronic
945956726 2:216093256-216093278 CCACTTTGGTAGAAGAGCCCTGG + Intronic
946015510 2:216600961-216600983 CCATCTTGGAAGCACAAACTTGG + Intergenic
946152628 2:217786672-217786694 ACAGTGTGGAAGCAGAGAGCGGG + Intergenic
946472840 2:219978714-219978736 CCATCTTGAAAGTTGAGACCAGG + Intergenic
946628470 2:221640993-221641015 CCATCTTGGAAGCAAAGACCAGG - Intergenic
946978282 2:225177573-225177595 CCATCTTGGAAGAGGACACCAGG - Intergenic
947402763 2:229744883-229744905 CCATCTTGGAAGCAGAAAGCTGG - Intergenic
947459590 2:230292293-230292315 CAAATTTGGAAGTAGAGGCCAGG - Intronic
948654860 2:239470278-239470300 CCATCTTGGGAGCAGAGACCGGG + Intergenic
1169770178 20:9191409-9191431 CCCTCTTAGAAGCAGAGACCAGG + Intronic
1170023480 20:11863075-11863097 CCATCTTGGAAGAAGAGATTGGG + Intergenic
1170534007 20:17322659-17322681 CCATCTTGGAAGGAGAGACTGGG - Intronic
1171394792 20:24825049-24825071 TCATCTTGGAAGCAGACACTAGG - Intergenic
1171416173 20:24982166-24982188 CCATTCTGAAAGCTGAGCCCAGG + Intronic
1171534050 20:25870548-25870570 CCATCTTGGATGCAGAGACCAGG - Intergenic
1171571221 20:26253420-26253442 CCATCTTGGATGCAAAGGCCAGG - Intergenic
1171793078 20:29546304-29546326 CCATCTTGGATGCAGAGACCAGG + Intergenic
1171855374 20:30338102-30338124 CTATCTTGGATGCAGAGACCAGG - Intergenic
1173418703 20:42881316-42881338 CGATTTTGAAAGCAAAGAACAGG + Intronic
1173428124 20:42960316-42960338 CCATCTTGGAAGCAGAGAACAGG - Intronic
1173641626 20:44606896-44606918 CCCTCTTGGAAGCAGAGAGCAGG + Intronic
1173741155 20:45403400-45403422 CCATCTAGGATGCAGAAACCTGG - Intronic
1174688508 20:52479163-52479185 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1174856750 20:54052707-54052729 CCATCTTGGAAGTAGAGAACAGG + Intronic
1176158464 20:63635851-63635873 CCATCGTGGAAGCAGAGACCAGG - Intergenic
1176311304 21:5151885-5151907 CCTGTTTGGTGGCAGAGACCTGG + Intronic
1176630941 21:9136772-9136794 CCCTTTGGGAAGCCCAGACCTGG - Intergenic
1176691737 21:9919409-9919431 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1177000740 21:15609170-15609192 TCATTTTGGGAGCAGAAACCAGG + Intergenic
1177630770 21:23724812-23724834 CCATTTTTGAAGCAGGAAGCAGG - Intergenic
1177921725 21:27161081-27161103 CCATATTGGAAGCAGAAAGTGGG + Intergenic
1178839066 21:36124077-36124099 TCATCTTGGAAGCACAGACCAGG + Intergenic
1178907812 21:36650871-36650893 CCATCTTGGGAGTGGAGACCAGG + Intergenic
1178952693 21:36998256-36998278 CCATCTTGGAAGCAGAGACCAGG - Intergenic
1179400623 21:41079897-41079919 CCATCTTGGAGGCAGAGACAGGG - Intergenic
1179845746 21:44110150-44110172 CCTGTTTGGTGGCAGAGACCTGG - Intronic
1180146236 21:45920772-45920794 CCATATTGAAAGCAGAGACTTGG + Intronic
1180375649 22:12090834-12090856 CCCTTTGGGAAGCCCAGACCTGG + Intergenic
1180573396 22:16750440-16750462 CCATCTTGGATGCAGAGGTCAGG - Intergenic
1180799966 22:18627174-18627196 CCCTTTTGGAACCAGAGGCTTGG - Intergenic
1180820107 22:18821311-18821333 TGATTTGGGAATCAGAGACCTGG - Intergenic
1180842202 22:18964695-18964717 CCATGGTGGGAGCAGAGCCCGGG - Intergenic
1181206330 22:21255783-21255805 TGATTTGGGAATCAGAGACCTGG - Intergenic
1181221749 22:21368092-21368114 CCCTTTTGGAACCAGAGGCTTGG + Intergenic
1181450991 22:23020557-23020579 CCATCATGGAAGCAGAGATTGGG + Intergenic
1181637116 22:24179695-24179717 CCCTTTTGGAACCAGAGGCTTGG + Intergenic
1182788150 22:32925207-32925229 TGATGTTGGAAGCAGAGACTGGG - Intronic
1183099876 22:35577302-35577324 CCATTTTGCAAATAGAGACTTGG - Intergenic
1183653061 22:39170046-39170068 GCATTTAGTAAGCAGAGAGCAGG - Intergenic
1184054189 22:42033359-42033381 CCCTTTGGGAAGCCCAGACCTGG - Intronic
1184619983 22:45669987-45670009 CCATTTGGGAGGCTGAGACAAGG - Intergenic
1203220590 22_KI270731v1_random:39640-39662 TGATTTGGGAATCAGAGACCTGG + Intergenic
1203270234 22_KI270734v1_random:47182-47204 TGATTTGGGAATCAGAGACCTGG - Intergenic
949494298 3:4617351-4617373 CCATCTTGAGAGCAGAGACCAGG - Intronic
949578693 3:5364428-5364450 CCATCTTGGAAACAGAGAATGGG + Intergenic
950194925 3:11002440-11002462 CCATTTTGGAAGCGGAAAGAGGG + Intronic
951241250 3:20288231-20288253 CCATGGTGGAAGGAGAGGCCTGG + Intergenic
951557331 3:23933867-23933889 CCATCTTGGAAGCAGAGACTGGG - Intronic
951680898 3:25293776-25293798 TCATTTTGGTGGCAGAGAACAGG - Intronic
951703671 3:25522701-25522723 TCATTCTGGAAGCACAGCCCCGG + Intronic
951870479 3:27356124-27356146 CCATCTTGGAAGCAGGGACTGGG + Intronic
951927978 3:27930668-27930690 GCATCTTGGAGGTAGAGACCAGG - Intergenic
952373533 3:32746229-32746251 CCTTTTTGGCACCAGGGACCAGG + Intronic
952520029 3:34147323-34147345 TAATTTTGGAATCAGAGACTAGG - Intergenic
952615962 3:35274288-35274310 CCATCTTGGAAGCAGAGACTAGG + Intergenic
953145365 3:40270044-40270066 CCATCTTGGAAGCAGAGAGTGGG - Intergenic
953772130 3:45785841-45785863 CCATGTTGGTACCAGAGCCCAGG + Intronic
953899499 3:46831725-46831747 CCCTTTTGAAAGAACAGACCAGG + Intronic
954161911 3:48728909-48728931 TCACATTGGGAGCAGAGACCAGG + Intronic
956048872 3:65225780-65225802 CCAGTTTGGAAGCAGAACCCTGG - Intergenic
956085410 3:65603800-65603822 CCATCTTGGAAGGAGAGACCAGG - Intronic
956148442 3:66215962-66215984 CCATCTTGGAAGCAGGAACTGGG - Intronic
956735587 3:72235517-72235539 TCATCTATGAAGCAGAGACCAGG - Intergenic
956765506 3:72481181-72481203 CCATCTTAGAAGCAGAGACTGGG + Intergenic
956773548 3:72547027-72547049 CCATCTTGGAAGCAGAGGCCAGG + Intergenic
957436766 3:80187543-80187565 CCATTTAGGAAGCAGTGAAGAGG - Intergenic
957817272 3:85317553-85317575 CTACCTTGGAAGCAGAGACTTGG - Intronic
958002679 3:87771585-87771607 CCATCTTGGAAGCAGAGCACAGG - Intergenic
959154785 3:102653559-102653581 CCATTTTGGAAGTGAAGACCTGG + Intergenic
959314705 3:104788386-104788408 CCATTTTTTCAGCAGAGATCTGG - Intergenic
959356579 3:105337962-105337984 CTATCTTGGAAGCAGTGACTTGG + Intergenic
959594217 3:108111575-108111597 CCGTCTTGGAAACAGAGTCCAGG - Intergenic
960137581 3:114121491-114121513 CCATCTTAAAAGCCGAGACCAGG + Intergenic
960268539 3:115649183-115649205 CCATCTTGGAGACAGAGACCAGG - Intronic
960977874 3:123194024-123194046 CCGTCTTGGAAGCAGAGATCAGG - Intronic
962445839 3:135463860-135463882 TCATCTTGGAAGCAGAGAGCAGG + Intergenic
962611853 3:137084254-137084276 CCATTTGGGAAACATAAACCTGG - Intergenic
962674950 3:137748999-137749021 CCATTCTAGAATCAGAGACGAGG + Intergenic
962742632 3:138373065-138373087 CCATCTTGGACGGTGAGACCTGG + Exonic
963533667 3:146501734-146501756 CCATCTTGGAAGTAGAGACCAGG - Intergenic
963713556 3:148776216-148776238 CCATCTTGGAAGCAGAGACCAGG + Intergenic
964434393 3:156636476-156636498 CCATCTTGGAAGCAGAGACCTGG - Intergenic
964593803 3:158398386-158398408 CCATCTTGGAAGCAGACACCTGG - Intronic
964663217 3:159143905-159143927 CCATCTTGGAAGCTGAGACCAGG - Intronic
966476987 3:180360498-180360520 CCATCTTGCAAGCAGTGACCAGG + Intergenic
966752532 3:183335985-183336007 CCATCTTGGAAGGAGAGACTGGG + Intronic
966768993 3:183487141-183487163 CAATTTGAGAAGCACAGACCAGG + Intergenic
966917250 3:184591936-184591958 TCATTTTGCACACAGAGACCTGG - Intronic
967268402 3:187712828-187712850 CCCTTTTGGAAACAGTGACAAGG - Intronic
968044952 3:195618772-195618794 CCATTCCAGAAGCAGAGACCAGG + Intergenic
968060736 3:195724824-195724846 CCATTCCAGAAGCAGAGACCAGG + Exonic
968630118 4:1646023-1646045 CCATCTTGGAAGCAGAGGGCAGG + Intronic
970433340 4:16009477-16009499 CCATTTTGCTAACAGCGACCCGG + Intronic
970464717 4:16310968-16310990 CCATCTTGGAAGCAGATACTGGG + Intergenic
970568921 4:17360413-17360435 CCATATTGGAAGCACAGAGCAGG - Intergenic
970579108 4:17458073-17458095 CCATCTTGGAAACAAAGAGCAGG + Intergenic
970694980 4:18666661-18666683 CCATACTGGAAGCAAAGACCAGG - Intergenic
971090319 4:23335675-23335697 CCATCTTGGAGGCAGAGACCAGG + Intergenic
971766236 4:30835520-30835542 CCTTTTTGGCATCAGGGACCCGG - Intronic
972371373 4:38426649-38426671 TCATCTTGGAAGCAAAGACCAGG + Intergenic
972504792 4:39710706-39710728 ATATTTTGGACGCACAGACCTGG - Intronic
972732998 4:41813662-41813684 CCATCTTGGAAGTAGAGAGATGG - Intergenic
972987734 4:44785271-44785293 CCATCTTGGAAGAAGAGACCAGG - Intergenic
973854748 4:55000075-55000097 CCATCTTGGAAGAAGAGACGGGG + Intergenic
974142704 4:57908295-57908317 CCTTTTTGGCACCAGGGACCAGG + Intergenic
975274944 4:72485919-72485941 CTATCTTTGAAGCAGAGACTGGG + Intronic
976040160 4:80874579-80874601 CCATCTTGGAAGCAGAAAGGAGG - Intronic
976129212 4:81866984-81867006 CCATCTTGGAAGCAAGGACTGGG - Intronic
976872343 4:89810513-89810535 CCATCTTGGGAGTAGAGAACCGG + Intronic
976950306 4:90820412-90820434 CCATCTTGGAAGCAGAGAGATGG - Intronic
977149904 4:93498232-93498254 CCATCTTGGAAGCAGAAACCTGG - Intronic
977603771 4:98961508-98961530 CCCTATTGGAAGCAGAGACGAGG + Intergenic
977700957 4:100022285-100022307 CCATCTTGGAAGCAGGGAGCAGG - Intergenic
977775540 4:100915180-100915202 CCATTTTGGAAGCAGAGACTAGG + Intergenic
978827878 4:113046589-113046611 CCATCTGGGAAGAAGAGACCTGG + Intronic
979288279 4:118951256-118951278 GCATCTTGGAAGCAGAGAAGGGG - Intronic
979526360 4:121721511-121721533 CCATCTTGGAAGCAGAGAGAAGG + Intergenic
979593384 4:122506016-122506038 ACACCTTGGAAGCAGAGACTGGG - Intergenic
979748141 4:124242782-124242804 CCATCTTGGAAGCAGAGACCAGG + Intergenic
980007671 4:127559945-127559967 CCCTTTAGGAAGCCCAGACCTGG + Intergenic
980364317 4:131779615-131779637 CCATTTTAGAAGCAGAAACTGGG + Intergenic
980727134 4:136777109-136777131 GCATTTTGGCAGCGGAGACTGGG + Intergenic
980731495 4:136830378-136830400 TCATTTTGGAAGCTGAGACTGGG - Intergenic
981407467 4:144387689-144387711 CCATTTTGGAAGCAGAGACCAGG - Intergenic
981613953 4:146626522-146626544 CTATCTTGGAAGCAGAGACTGGG + Intergenic
981709544 4:147695566-147695588 CCATCTTGGTAGCAGAGCCTGGG - Intergenic
981735925 4:147950320-147950342 CCATTTTGGCAGCAGGGTTCTGG + Intronic
981911845 4:149991093-149991115 CCATCTTGGAAGTAGAGACCAGG - Intergenic
982148196 4:152421625-152421647 GCATGTTGAAAGCAGAGACAGGG - Intronic
983208678 4:164936487-164936509 CCATCTTGGAAGCAGAGACCAGG + Intergenic
983635100 4:169889844-169889866 CCATCTTGGATGCAGAAAACAGG + Intergenic
984203886 4:176762429-176762451 CCACCTTAGAAGCAGAGACGGGG + Intronic
984255367 4:177384101-177384123 CCATCTTGGTAGCGGAGATCAGG - Intergenic
984411606 4:179404724-179404746 CCACATTGGGAGCAGAGACTAGG - Intergenic
984851031 4:184152529-184152551 CCATTATGGAGGAAGATACCAGG - Intronic
984900658 4:184583287-184583309 CCATCTTGGATGCAGAGACCAGG + Intergenic
1202757247 4_GL000008v2_random:76275-76297 CCCTTTGGGAAGCCCAGACCTGG + Intergenic
986027104 5:3860946-3860968 CCATTTCTGTAGCAGACACCCGG - Intergenic
986179793 5:5382936-5382958 CCATCTTGGAAGCAGAGACTGGG + Intergenic
986503037 5:8420555-8420577 ACATTTTGGAAGTGGAGAACAGG + Intergenic
986752053 5:10796063-10796085 CTATCTTGGAAGCAGAGAACAGG - Intergenic
987220148 5:15783018-15783040 CCAATGTGCAAGCAGAGAGCGGG + Intronic
987238160 5:15964680-15964702 CCATCTTGGAAGCAGTGAACAGG + Intergenic
987559247 5:19496908-19496930 TCATCTTGGAAGCAGAGCCCAGG + Intronic
987647570 5:20694167-20694189 CAATCTTGGAAGTGGAGACCAGG + Intergenic
987724172 5:21676166-21676188 CCAACTTGGAAACAGAGATCAGG - Intergenic
988363616 5:30267580-30267602 CCATCTTTGAAGCAGAGAGTGGG + Intergenic
988673305 5:33405503-33405525 CCATCTTGGAAGCAGAGAACAGG + Intergenic
988886746 5:35566083-35566105 CCATTTATGAAGCAGAGAATGGG + Intergenic
989561979 5:42862951-42862973 CCATCTTGGAACCAGATCCCAGG - Intronic
989806837 5:45619033-45619055 CCATTTTCAAAGCAAATACCAGG - Intronic
990022366 5:51143245-51143267 CCATCTTGAAAGCAGAGACCAGG + Intergenic
990311932 5:54548487-54548509 GCAATTTGGAGCCAGAGACCTGG + Intergenic
990428024 5:55707948-55707970 CCATCTTGGAAGCAGAGACCGGG + Intronic
990625704 5:57608054-57608076 ACATCTTGGAGGCAGAGAGCAGG + Intergenic
990976008 5:61562559-61562581 ACCTCTTGGAAGCAGACACCCGG - Intergenic
991929040 5:71733566-71733588 CCATCTTGGAAGCAGAGACCAGG - Intergenic
992272260 5:75077241-75077263 CCATTTTTAAAATAGAGACCGGG + Intronic
992806065 5:80339220-80339242 CTATTTGGGAAGCTGAGACAGGG - Intergenic
993108186 5:83623891-83623913 CCATTCTGGAAACAGAGACTGGG + Intergenic
993212506 5:84970800-84970822 CCATCTTGGAAGTACAGATCAGG + Intergenic
993304203 5:86254359-86254381 TCATCTTGGGAGCAGTGACCAGG + Intergenic
993601001 5:89924821-89924843 TCATCTTGGAAGCAGAGACTGGG - Intergenic
994015972 5:94965911-94965933 ATATCTTTGAAGCAGAGACCAGG + Intronic
994335601 5:98561878-98561900 CCATCTTGGAAGTGGAGACCAGG + Intergenic
994727599 5:103454589-103454611 TCATTTTGAAAGGAGTGACCTGG + Intergenic
994773761 5:104017509-104017531 CCATCTTGGAAGCAGAGACCAGG - Intergenic
994868107 5:105305328-105305350 CAATTTGGGAAGTAGAGAGCTGG + Intergenic
995335623 5:110995710-110995732 CCATCTTAGAAGCAGAGGCTAGG + Intergenic
995655375 5:114420421-114420443 TGCATTTGGAAGCAGAGACCAGG - Intronic
996871996 5:128202172-128202194 CCATCTTGGAAGCAGAGATGGGG - Intergenic
997052151 5:130395562-130395584 CAATTTTGGAATACGAGACCTGG - Intergenic
997100947 5:130968869-130968891 CCATCTTAAAAGCAGAGACCAGG + Intergenic
997107412 5:131035990-131036012 CCATATTGGAAGCAGATAACAGG - Intergenic
997282959 5:132659942-132659964 CCATTGTGGCAGCAGGGACGTGG + Intronic
997644193 5:135469233-135469255 CCAGTTTGGAAGAAGAGAAGAGG + Intergenic
997708477 5:135981644-135981666 CCATCTTGGGAGCAAAGACTGGG + Intergenic
997989372 5:138531327-138531349 CCATCTTAAAAGCAGAGAGCAGG + Intronic
998458442 5:142291789-142291811 CCATCTTGGAGGCAAAGACCGGG - Intergenic
998871224 5:146554531-146554553 CCAACTTGCAAGCAGAGACCAGG - Intergenic
998932322 5:147194879-147194901 CTATCTTGAAAGTAGAGACCAGG - Intergenic
998971315 5:147595459-147595481 CCATCTTGGAAGTAGACACCAGG + Intronic
999392226 5:151201794-151201816 TCATTCTTGAGGCAGAGACCAGG - Intronic
999575540 5:152972595-152972617 CCATTTTGGATTAAGAAACCAGG - Intergenic
999734220 5:154500558-154500580 CCACCTTAGAAGCAGAGACCAGG - Intergenic
999895439 5:156027873-156027895 GCATCTTGGAAGCAAAGACCAGG - Intronic
1000201101 5:159011976-159011998 GCATTTTCTAAGCAGAGACCAGG - Intronic
1002077620 5:176718260-176718282 GCATGGTGGAAGCAAAGACCAGG - Intergenic
1002357639 5:178643655-178643677 CCATCTTGAAAGCAGAGACCAGG + Intergenic
1002427452 5:179184726-179184748 CCAGTGGGGAAGGAGAGACCAGG - Intronic
1003058322 6:2842280-2842302 TCATCTTGGAAACAGAGAGCAGG - Intergenic
1003308397 6:4948301-4948323 ACATTTTGGAAGTGGAGCCCTGG + Intronic
1003833456 6:10040784-10040806 CCATCTTGGAAGCAGAGAGCAGG - Intronic
1004019532 6:11764214-11764236 TAATTTTGGAAGCAGAGAGCTGG - Intronic
1005214532 6:23509645-23509667 CCATCTTGGAAGCAGAGATGGGG + Intergenic
1005353519 6:24960307-24960329 CCATCTTGGAAGCAGAGACCAGG - Intronic
1005376794 6:25190847-25190869 CCAATTTGGAAGCAGAGATTGGG + Intergenic
1005443118 6:25893210-25893232 CTATCTTGGAAGCAGAGACCTGG - Intergenic
1005641695 6:27802303-27802325 CCAATTTGGAAGCAGAGACCTGG + Intergenic
1006814821 6:36843027-36843049 CCATCTTGGAAGCAGAGACCTGG - Intergenic
1007387035 6:41527222-41527244 TGATTTTGGAAGCTGAGACTGGG - Intergenic
1009501377 6:64418944-64418966 CATTTCTGGAAGCAGAAACCTGG - Intronic
1010324528 6:74549783-74549805 CCATTTAGAAATCAGAGACTAGG + Intergenic
1010367605 6:75069908-75069930 TCATCTTGGAAGCAGGGAACAGG + Intergenic
1010473484 6:76259033-76259055 CCATTTTGGAGGCAGAAACCAGG - Intergenic
1010654340 6:78494437-78494459 CCATCTTGGAAGCATAAACTGGG - Intergenic
1010891647 6:81319918-81319940 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1011038449 6:83002773-83002795 CCATCTTGGAAGCAGACATGGGG + Intronic
1011368556 6:86607505-86607527 CTATGTTGCAAGCAGAGAACAGG + Intergenic
1011855538 6:91685114-91685136 TCACCTTGCAAGCAGAGACCAGG - Intergenic
1012874734 6:104712879-104712901 TCACCTTGGAAGCTGAGACCAGG + Intergenic
1014771425 6:125462085-125462107 CCATCTTAGGAGTAGAGACCAGG - Intergenic
1014796988 6:125736773-125736795 TGGTTTTGGAATCAGAGACCTGG - Intergenic
1015840985 6:137477021-137477043 CCATCCTGAAAGCAGAGACCAGG + Intergenic
1015957657 6:138615096-138615118 TAATTTTGCAAGCCGAGACCTGG - Intronic
1016806851 6:148220224-148220246 CCATTGAGGAAGCAGAGACGGGG - Intergenic
1017173016 6:151475691-151475713 CCATCTTGGAAGCTGAGACCAGG - Intergenic
1017681985 6:156873486-156873508 CAATTTTTGAAGGAGAGAACTGG + Intronic
1020565752 7:9793509-9793531 CCATTTTGAAAGCAGAGAGATGG - Intergenic
1020590025 7:10124004-10124026 TCATCTTGGAAGCAGAGACCAGG - Intergenic
1020597300 7:10223771-10223793 CCACTTTGGAAGTGGAGACCAGG - Intergenic
1021117117 7:16756317-16756339 ACATTTTAGAGGCAGTGACCAGG - Intronic
1021539634 7:21742942-21742964 CCATTTTGGAAGCAGAGACCAGG - Intronic
1021943841 7:25705602-25705624 CCATCTTGGAAGCGGAGACAGGG + Intergenic
1022371089 7:29772337-29772359 CCAACTTGGGAGCAGAGACTAGG - Intergenic
1022477469 7:30721067-30721089 CCATCTTAGAAGCAGAGACTGGG - Intronic
1022640773 7:32180560-32180582 TCATCTTGGAAGCAGAAATCAGG + Intronic
1022841124 7:34164707-34164729 CCATCCTGGAGGCAGAGACTGGG + Intergenic
1023028177 7:36070792-36070814 ACATTTTGGGAGCAGAGACTGGG + Intergenic
1023358590 7:39392951-39392973 ACATTTAGGAAGAAGAGAGCAGG - Intronic
1023593225 7:41800919-41800941 GCATTTTTGAAGCAGAAAGCTGG - Intergenic
1023848900 7:44139729-44139751 CCGTGGTGGAAGCAGAGAGCGGG - Intronic
1024265421 7:47602583-47602605 CCATTTTGGAAGAGCAGACCAGG + Intergenic
1024267576 7:47618648-47618670 CCATCTTTGAAGCAGAGAATGGG + Intergenic
1024537207 7:50447113-50447135 ACAGTTTGGTAGCACAGACCTGG + Exonic
1024939955 7:54751957-54751979 CCAGCTTGTAAGCAGAGGCCAGG + Intergenic
1025285521 7:57657479-57657501 CCATCTTGGATGCAGAGACCAGG - Intergenic
1026182508 7:68054312-68054334 CCATCTATGAAGCAGAGAGCAGG + Intergenic
1026965428 7:74436269-74436291 CCATCTTGGAAGCAGAGACTAGG - Intergenic
1027989924 7:85345209-85345231 TCATCTTGAAAGCAGAGACTGGG - Intergenic
1028624085 7:92858060-92858082 CCAGCTTGGAAGCAGAGACTGGG + Intergenic
1028970563 7:96854039-96854061 CCATCTTGGAAGCAAACACTGGG - Intergenic
1028975441 7:96907940-96907962 CTATCTTGGAAGCAGACACAGGG + Intergenic
1029851399 7:103465077-103465099 CCATTTTGCAAGCAGTGATATGG - Intergenic
1030408844 7:109148524-109148546 CTATCTTGCAAGCAGAGACCAGG - Intergenic
1030481515 7:110110623-110110645 CCATCTTGGAAGCAGAGACCAGG + Intergenic
1030671675 7:112345119-112345141 CCATCTTGGAAATAGAGACTGGG - Intergenic
1030800316 7:113842090-113842112 ATATTTTGGAAGCAGTGAGCAGG + Intergenic
1030817172 7:114052544-114052566 CCATCTTGGAAGGAGAGACTGGG + Intronic
1030867896 7:114721823-114721845 CTATCTTGGAAGTAGAGACAGGG + Intergenic
1031634863 7:124090455-124090477 TCATCTTGGAAGCAGAGACAGGG + Intergenic
1031838817 7:126712083-126712105 CCATGTTGAAAGCTGAGACAGGG - Intronic
1032445069 7:131975141-131975163 CCATCTTGGGAGCAGAGACTGGG + Intergenic
1032475400 7:132208407-132208429 CTGCTTTGGAAGCAGTGACCTGG + Intronic
1032876846 7:136047045-136047067 CCATCTTGGAAGCAGAGACGAGG - Intergenic
1033148270 7:138890458-138890480 CCATTTAGGAAGTGGAGACAAGG + Intronic
1033686783 7:143647423-143647445 CCATCTTGGGAGCACAGAGCAGG + Intronic
1033688951 7:143719884-143719906 CCATCTTGGGAGCACAGAGCAGG - Exonic
1033697826 7:143810191-143810213 CCATCTTGGGAGCACAGAGCAGG - Intergenic
1034278733 7:149837252-149837274 CCCTCCTGGAAGCAGAGACCAGG - Intergenic
1034555564 7:151848340-151848362 CCACCTTGGAAGCAGAGACCAGG + Intronic
1035561914 8:611413-611435 CCATTTTGGAAGCATAATTCTGG - Intergenic
1037024024 8:14009855-14009877 TCATCTTAGAAGCAGAGACAAGG + Intergenic
1037643922 8:20773108-20773130 CCTTCTGGGAAGCAGAAACCAGG + Intergenic
1039083758 8:33759660-33759682 CCATCTGGGAAGCAAAGACTGGG - Intergenic
1039429408 8:37513987-37514009 TCATTTTCTAAGTAGAGACCTGG + Intergenic
1039883476 8:41641899-41641921 CCAACTTGGAAGCAGAGACCAGG - Intergenic
1040820640 8:51552952-51552974 GCATTTTGGAAGCACATAACTGG - Intronic
1040984563 8:53279667-53279689 CCATCTTAGAAGCAGAGAGATGG + Intergenic
1042211873 8:66389395-66389417 CCAACTTGGAAGTGGAGACCAGG - Intergenic
1042387718 8:68197044-68197066 CTATCTTGGAAGCAGAAACCAGG - Intronic
1042851154 8:73217230-73217252 CCATCTTGGAAGCAAAGACCAGG + Intergenic
1043199866 8:77353334-77353356 CCATCTTGGAAGCAGAAACCAGG + Intergenic
1043538119 8:81228445-81228467 CGGTCTTGGAAGCAGAGACCAGG - Intergenic
1043716437 8:83492934-83492956 CCACCTTGGAAGCAGAGACTGGG - Intergenic
1043794161 8:84514489-84514511 CCATCTTGGAAGCAAAGAGTGGG - Intronic
1044423213 8:92022619-92022641 CCATCTTGAGAGCAGAGACCAGG + Intronic
1044794976 8:95887498-95887520 CCATCTTGGAAGCACAGACTGGG - Intergenic
1044900166 8:96935499-96935521 CTCTTTTGGAAACAGAAACCTGG - Intronic
1044928674 8:97231308-97231330 CCATGTTGGAAATGGAGACCAGG + Intergenic
1045136956 8:99231966-99231988 GCATTTTGGAAGAAGAAAACAGG - Intronic
1045142034 8:99296808-99296830 CCATCTTGGAAACAGAGACCAGG + Intronic
1045408374 8:101890653-101890675 CACTCTTGGAAGCAGAGACTAGG + Intronic
1045424630 8:102052605-102052627 CCATTTTGGAAACTGTTACCAGG - Intronic
1045904451 8:107326604-107326626 CCATTTTGGAAGTAATGACAAGG - Intronic
1046226534 8:111287138-111287160 CCATTTTGGAAACAGACGCTGGG + Intergenic
1046268553 8:111862485-111862507 CCATTTTGGAAATGCAGACCAGG - Intergenic
1046292568 8:112181873-112181895 CCATTTTGGAAGCAGTGACCTGG + Intergenic
1046418683 8:113949188-113949210 TCGTCTTAGAAGCAGAGACCAGG + Intergenic
1046623165 8:116549452-116549474 CTATCTTGGAAGCGGAGACCAGG + Intergenic
1046741860 8:117837474-117837496 TGATTTTGGAAGCAAAGACTGGG - Intronic
1047395455 8:124494051-124494073 CCATTTTGGAAGCTGAATCACGG - Intronic
1048049987 8:130807578-130807600 CCATCGTGGAAGCAGAAACAAGG + Intronic
1048234649 8:132677781-132677803 CCATCTTGGAAGTGGAGACCAGG - Intergenic
1048274941 8:133058996-133059018 CCATTTTGGAAGCAGTGAGAAGG + Intronic
1048347074 8:133584079-133584101 CCATCTATGAAGCAGAGAACAGG + Intergenic
1048507650 8:135035315-135035337 CCATTTTGGTAGAAGAGAAAAGG + Intergenic
1049665926 8:143842569-143842591 CCATATTGTTAGCACAGACCAGG - Intergenic
1050102498 9:2133743-2133765 CAGTTTAGGAAGCAGAGACAGGG + Intronic
1050706346 9:8403215-8403237 AGATTTTGGAAGCAGAAAACAGG + Intronic
1050930435 9:11316371-11316393 CCATATTGGAATAAGAGAACTGG + Intergenic
1051352033 9:16206053-16206075 CCATCTTTGAAGCAGAGGCAAGG - Intronic
1051512108 9:17889530-17889552 CTATTTTGGAAGCGTAGACAAGG - Intergenic
1051831937 9:21288988-21289010 CCTTTTTGGCACCAGAGACTGGG - Intergenic
1052005318 9:23340717-23340739 CCAGCTTGGAAGCAGAGACAAGG + Intergenic
1052449507 9:28610597-28610619 TCATCGTGAAAGCAGAGACCAGG + Intronic
1052732257 9:32302310-32302332 CTATCTTGGAAGCAGAAACCAGG + Intergenic
1052894355 9:33733535-33733557 CCATTCTGGAAGCTGCGTCCTGG + Intergenic
1053033903 9:34808629-34808651 CCATCTTGGAAGTAGAGACCAGG - Intergenic
1053038045 9:34842615-34842637 CCATCTTGGAAGCAGAGACTGGG + Intergenic
1053628672 9:39905502-39905524 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1053676900 9:40440450-40440472 CCATTTTGCAAGCTGAGAAATGG - Intergenic
1053777394 9:41560838-41560860 CCATTTTAGAAGCAGAAACTGGG - Intergenic
1053793201 9:41701387-41701409 CCATCTTGGATGCAGAGACCAGG - Intergenic
1053926666 9:43066547-43066569 CCATTTTGCAAGCTGAGAAATGG - Intergenic
1054151974 9:61613452-61613474 CTATCTTGGTTGCAGAGACCAGG + Intergenic
1054181610 9:61913399-61913421 CCATCTTGGATGCAGAGACCAGG - Intergenic
1054215215 9:62345200-62345222 CCATTTTAGAAGCAGAAACTGGG - Intergenic
1054286816 9:63184457-63184479 CCATTTTGCAAGCTGAGAAATGG + Intergenic
1054289970 9:63275973-63275995 CCATTTTGCAAGCTGAGAAATGG - Intergenic
1054388001 9:64580517-64580539 CCATTTTGCAAGCTGAGAAATGG - Intergenic
1054471748 9:65544582-65544604 CCATCTTGGATGCAGAGACCAGG + Intergenic
1054507722 9:65935852-65935874 CCATTTTGCAAGCTGAGAAATGG + Intergenic
1054672266 9:67810149-67810171 CCATTTTAGAAGCAGAAACTGGG + Intergenic
1054716600 9:68563266-68563288 CAATTTTGGAAGGAGAAACTTGG + Intergenic
1054793249 9:69275437-69275459 CCATGTGGGAAGCAAAGACATGG - Intergenic
1055436636 9:76298228-76298250 GCATTTTGCAAGCAGAAACCAGG + Intronic
1056744291 9:89286718-89286740 CCATCTTGTAAGCGGAGACCAGG + Intergenic
1057067932 9:92072833-92072855 CCACATTGGGAGCAGAGACTAGG - Intronic
1057149793 9:92786155-92786177 GCCTTTTGTAGGCAGAGACCAGG - Intergenic
1057882572 9:98803618-98803640 ACATATTGGAAGGAGAGAGCAGG + Intergenic
1058162182 9:101581581-101581603 CCATCTTGGAAGCAGAGACTGGG + Intronic
1058562424 9:106244096-106244118 TCAATTTGGAAACTGAGACCTGG + Intergenic
1058610558 9:106771223-106771245 CCATCTTGGAAGTAGAGACCAGG + Intergenic
1058800188 9:108538094-108538116 CCCTTTGGGAGGCAGAGACAGGG + Intergenic
1059261721 9:112983517-112983539 CCATCTTAGAAGCAGAGACTGGG - Intergenic
1060706486 9:125806458-125806480 CCATCCTGGAAGCAGAAGCCTGG - Intronic
1060841733 9:126799039-126799061 CCATCTTGGAAGTAGAGGCTGGG - Intergenic
1060849636 9:126863133-126863155 CAGCTTTGGAATCAGAGACCTGG + Intronic
1061266670 9:129509796-129509818 CCATGTTTGAAGCAGGGAACGGG - Intergenic
1061446416 9:130640696-130640718 CCACCTTGGAAGCAGGTACCTGG - Intergenic
1061711331 9:132490044-132490066 CCATCTTGGAAGCAAAGACTAGG - Intronic
1062145538 9:134987726-134987748 CCATTTTAGAAGCAAAGTCCTGG - Intergenic
1062490783 9:136803917-136803939 CCCTTTCTGAAGCACAGACCTGG - Intronic
1203753771 Un_GL000218v1:104474-104496 CCCTTTGGGAAGCCCAGACCTGG - Intergenic
1203538037 Un_KI270743v1:61136-61158 CCCTTTGGGAAGCCCAGACCTGG + Intergenic
1186566331 X:10666826-10666848 CCATAGTGGAAACAGAGAACAGG - Intronic
1186683101 X:11896522-11896544 CCATTTGTGAAGCAGAAAGCAGG + Intergenic
1186870810 X:13769807-13769829 CCATCTTGGAAGCCGAGACCGGG + Intergenic
1188021619 X:25164835-25164857 GCAGTTTGTAAGCTGAGACCAGG + Intergenic
1188049046 X:25461946-25461968 ACATCTTGGAAACAGAAACCTGG - Intergenic
1188559913 X:31455918-31455940 CCAATTTGGTAGTAGAGCCCAGG - Intronic
1188692589 X:33148984-33149006 CCTTTTTGGCACCAGAGACTGGG + Intronic
1188703864 X:33301639-33301661 TCATCTTCGAAGCAGAGACTGGG - Intronic
1188855888 X:35195302-35195324 ACATCTTGGAAGCAGAAAGCAGG + Intergenic
1189274498 X:39775547-39775569 TCATTTTGGAAGAAGAGACAGGG + Intergenic
1189302616 X:39963267-39963289 CCATCTTGGAAGTGGAGACTGGG + Intergenic
1189387413 X:40548717-40548739 GCATTTTGGAAGAAGAGAATGGG + Intergenic
1190124646 X:47693118-47693140 CCATCTTGGAAGCAGAGACTGGG - Intergenic
1190588822 X:51976110-51976132 CCATTTTGAGAGCAGAGTCACGG + Intergenic
1190618173 X:52259789-52259811 ACATTTAGGAAGCAAAAACCAGG + Intergenic
1191910690 X:66146281-66146303 CCATCTTGTAAGCAGAGATGGGG + Intergenic
1192094699 X:68198337-68198359 CCATCTTGGAAACAGAGACCAGG + Intronic
1192153331 X:68725303-68725325 CCCTTTCTCAAGCAGAGACCTGG + Exonic
1192438234 X:71155613-71155635 AAAGTCTGGAAGCAGAGACCTGG - Intronic
1192597693 X:72428739-72428761 CCATTTTGAAACTAGAGAACTGG - Intronic
1192741672 X:73899340-73899362 GTATTTTGTTAGCAGAGACCGGG - Intergenic
1193084116 X:77433421-77433443 CCATTTTGGAAGCAGACGCTGGG - Intergenic
1193299947 X:79878179-79878201 CCATCTTTGAAGCAGAGAGCAGG + Intergenic
1193550710 X:82889113-82889135 CCATTTTTGAAGGGGAGGCCAGG + Intergenic
1194182451 X:90730296-90730318 GCATTTTGGCAGCAGATACTGGG + Intergenic
1195215389 X:102695248-102695270 CCAATTTGGTATCAGAAACCTGG + Intergenic
1196470672 X:116021414-116021436 CCATTTTAGAAGTGGATACCAGG + Intergenic
1196593951 X:117521627-117521649 CCATCTTGGAAGCAGACACCGGG + Intergenic
1196941018 X:120775877-120775899 CTATCTTGGACGTAGAGACCAGG + Intergenic
1197034883 X:121861276-121861298 CCATCTTGGAAGCAAAGACCAGG - Intergenic
1197106165 X:122719143-122719165 CCATCTTGGAAGCAGAGTGAAGG - Intergenic
1197283146 X:124561787-124561809 CCATTTCCAAAGCAGAGCCCTGG + Exonic
1197734020 X:129836666-129836688 TCATCTTGGCAGCAGGGACCAGG + Intronic
1198263089 X:134983912-134983934 CCGTCTTGGAAGCAGACACCAGG + Intergenic
1198693113 X:139306121-139306143 CCATTTTGGAAGCAGAGAGTAGG - Intergenic
1199333490 X:146589217-146589239 CCATCTTGGAAGCAAAGATGGGG + Intergenic
1200367195 X:155679394-155679416 CCATCTTTGAAGCAGAGAGCAGG - Intergenic
1200529072 Y:4312254-4312276 GCATTTTGGCAGCAGATACTGGG + Intergenic
1200890060 Y:8313725-8313747 CCATAGTGGAAGCAGGGTCCAGG - Intergenic
1201167415 Y:11222033-11222055 CCCTTTGGGAAGCCCAGACCTGG - Intergenic
1202167508 Y:22006056-22006078 CCGTCTTGGAAGCAGAGACCAGG + Intergenic
1202169381 Y:22024986-22025008 CCATCTTGGAAGCAGAAACTAGG + Intergenic
1202221984 Y:22561379-22561401 CCATCTTGGAAGCAGAAACTAGG - Intergenic
1202223852 Y:22580313-22580335 CCGTCTTGGAAGCAGAGACCAGG - Intergenic
1202319263 Y:23615348-23615370 CCGTCTTGGAAGCAGAGACCAGG + Intergenic
1202321134 Y:23634288-23634310 CCATCTTGGAAGCAGAAACTAGG + Intergenic
1202549633 Y:26035768-26035790 CCATCTTGGAAGCAGAAACTAGG - Intergenic
1202551506 Y:26054709-26054731 CCGTCTTGGAAGCAGAGACCAGG - Intergenic