ID: 1021542034

View in Genome Browser
Species Human (GRCh38)
Location 7:21770541-21770563
Sequence CTGGTCCCTCCTCATGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 178}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021542034_1021542047 27 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542047 7:21770591-21770613 AGTAAATAATGCCGCTGGTAAGG No data
1021542034_1021542040 -2 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542040 7:21770562-21770584 AGTAGTTTCCCCTGGGATGGAGG 0: 1
1: 0
2: 1
3: 19
4: 176
1021542034_1021542049 29 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542049 7:21770593-21770615 TAAATAATGCCGCTGGTAAGGGG No data
1021542034_1021542046 22 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542046 7:21770586-21770608 CCAAGAGTAAATAATGCCGCTGG 0: 1
1: 0
2: 0
3: 2
4: 66
1021542034_1021542048 28 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542048 7:21770592-21770614 GTAAATAATGCCGCTGGTAAGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1021542034_1021542038 -5 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542038 7:21770559-21770581 ACCAGTAGTTTCCCCTGGGATGG No data
1021542034_1021542036 -10 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542036 7:21770554-21770576 GAGGGACCAGTAGTTTCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 104
1021542034_1021542037 -9 Left 1021542034 7:21770541-21770563 CCAGCCTCATGAGGAGGGACCAG 0: 1
1: 0
2: 1
3: 26
4: 178
Right 1021542037 7:21770555-21770577 AGGGACCAGTAGTTTCCCCTGGG 0: 1
1: 0
2: 0
3: 8
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021542034 Original CRISPR CTGGTCCCTCCTCATGAGGC TGG (reversed) Intronic
900285164 1:1895548-1895570 CTGGCCGCTCCCCATGAAGCTGG - Intergenic
901217105 1:7561064-7561086 CTGGGCGCTTCCCATGAGGCAGG + Intronic
901334188 1:8434580-8434602 CTGTTCTCTCCTCCTGAGCCTGG + Intronic
902631421 1:17706849-17706871 CTGGGCTCTCCGCCTGAGGCAGG + Intergenic
902705408 1:18200878-18200900 ATTATCCCTCCTCATGGGGCTGG - Intronic
902884473 1:19394915-19394937 CTGATCCTCCCTCATGACGCAGG + Intronic
904009028 1:27379569-27379591 CTGCTGCCTCCTCTCGAGGCAGG - Exonic
904329708 1:29750498-29750520 CTGGTCACTCCTGATCGGGCAGG + Intergenic
904349341 1:29894651-29894673 CTTGTCCTTCCCCATCAGGCTGG - Intergenic
904864751 1:33569576-33569598 CATGTCCCTCCTCTTGGGGCTGG - Intronic
906477116 1:46176588-46176610 CTGGCCCCTCCTCATGGGTCAGG + Intronic
907594699 1:55708546-55708568 CAAGACCGTCCTCATGAGGCTGG + Intergenic
912548314 1:110466881-110466903 CTGCTTCCTCCTCATGGGGCAGG - Intergenic
912717434 1:111991730-111991752 GTGGTCACTACTCAGGAGGCAGG + Intergenic
914860682 1:151383421-151383443 ATGGGCCCTGCTCATGAGTCAGG - Intergenic
915248233 1:154570859-154570881 CTGGTTGATCCTCATGAGGGTGG - Intronic
916016889 1:160757725-160757747 CTGGATCCTCCTCATGGGCCTGG - Intergenic
916415742 1:164590314-164590336 GTGGTAGCTCCTAATGAGGCTGG - Intronic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
920192671 1:204203467-204203489 CTGGTCCTTACTCAAGAGGCTGG + Intronic
920654255 1:207863973-207863995 CTGCTCCCTCCTCCTGCTGCTGG + Intergenic
920654622 1:207866593-207866615 CTGGACCCTCCTCATGTGCCAGG + Intergenic
921612253 1:217226567-217226589 CAGGACCCTCTTCAAGAGGCAGG - Intergenic
924211532 1:241772884-241772906 CTTGTCACTGCTCATGAGGATGG + Exonic
1062799535 10:368942-368964 CTGGGCGCTCCTCGTGGGGCTGG + Intronic
1063876325 10:10483036-10483058 CGGGTACTTCCTCATGTGGCTGG + Intergenic
1069707094 10:70465786-70465808 CTGGTCCCTCCTCAGGATGGAGG + Intergenic
1070528170 10:77312784-77312806 CTGAGCCCTCCACATGAGCCTGG + Intronic
1072501042 10:96018006-96018028 CAGTTACCTCCTCATGAGACAGG + Intronic
1074159931 10:110829080-110829102 CTGGTTCATCCTCCAGAGGCTGG + Intronic
1075161895 10:120031642-120031664 CTCGGCCTTACTCATGAGGCAGG - Intergenic
1075795177 10:125115095-125115117 CTGCTGCCTCCTCTTGAGGCTGG + Intronic
1083243078 11:61404160-61404182 ATGGTCCCTCCTCAAAGGGCTGG + Exonic
1083310228 11:61780128-61780150 GTGGTCCTTGCTCCTGAGGCTGG - Intronic
1083668057 11:64285936-64285958 CTCCTCCCTCCCCTTGAGGCTGG + Intronic
1085543896 11:77299122-77299144 CTGGACCCTCTTTATGAGACAGG + Intronic
1087811499 11:102613340-102613362 CCGGTCCCTGCTCATGGGGTTGG - Intronic
1091140702 11:133232005-133232027 CTCGTCCTTCCTGAGGAGGCTGG - Intronic
1091703139 12:2677292-2677314 CCGGTCCCTCCCCAGCAGGCTGG + Intronic
1092155542 12:6279434-6279456 CTGGTCTCTCCTCTGCAGGCTGG - Intergenic
1093356504 12:18173835-18173857 CTGGTCCCTCCTCTAGGGGAAGG + Intronic
1094555381 12:31494398-31494420 CTGGTAACTCATTATGAGGCAGG + Intronic
1096240903 12:49959866-49959888 CAGGTCTCTCCTCTTAAGGCCGG - Intergenic
1098232582 12:68387630-68387652 CTGGTTCCTCCTCATCATTCAGG + Intergenic
1100225358 12:92550841-92550863 ATGGTCACTGCTCATGAGTCAGG - Intergenic
1104267124 12:127244143-127244165 CTGGTTCCTGCTCATCACGCAGG - Intergenic
1108688652 13:52843605-52843627 CTGGTACCTCCTCCTCAAGCTGG - Exonic
1109397780 13:61783116-61783138 CTGGTTCCTCCTCATCATTCAGG + Intergenic
1112599116 13:100837958-100837980 GTGGTCTTTCCTCAAGAGGCAGG - Intergenic
1113791978 13:113033767-113033789 CTGGTTCCTCCTAACGAGGCTGG - Intronic
1114416264 14:22546529-22546551 CTGTTTCCTCCTCAAAAGGCAGG + Intergenic
1117328031 14:54686771-54686793 CTGCTGCCTCCTCATGTGACTGG - Intronic
1118711245 14:68521311-68521333 CTCCTCCCTTCTCATGAGCCAGG + Intronic
1119126233 14:72129852-72129874 GTGGTGCCTCATCATGAGGTGGG - Intronic
1119821334 14:77618549-77618571 CCGATCCCTCCTCAGGGGGCTGG + Intergenic
1121718684 14:96094538-96094560 CTGGTCTCTCCTCATCCAGCAGG - Intergenic
1122415418 14:101547360-101547382 CTGGTCCCTCCTTCTGTGGCTGG - Intergenic
1202847220 14_GL000009v2_random:190327-190349 CTGGTCCCACCTCATTAAGATGG - Intergenic
1202916683 14_GL000194v1_random:180889-180911 CTGGTCCCACCTCATTAAGATGG - Intergenic
1123774581 15:23566008-23566030 CAGGCTCCTCCTCCTGAGGCTGG - Exonic
1125832119 15:42724421-42724443 CTTGGGCCTCCTCGTGAGGCGGG + Exonic
1129194178 15:73954414-73954436 CTGCTCCCACCTCAGGGGGCAGG + Intergenic
1129985991 15:79920116-79920138 CTGGTCCTCTCTCATGAGGAAGG - Intronic
1132298446 15:100761709-100761731 CTGCTTCCTCCTCACAAGGCAGG - Intergenic
1132620857 16:867739-867761 GGGGTCCCTCCTCATGGGCCCGG - Intronic
1132783187 16:1639899-1639921 CTTGAGCATCCTCATGAGGCAGG - Intronic
1134292037 16:12909612-12909634 CTGGTCCCTCCTCATCACCAGGG + Intronic
1135538417 16:23312051-23312073 CTGGTCCCTTCTCCTAGGGCAGG - Intronic
1135721574 16:24822521-24822543 CTGCGCCCTCCTCTGGAGGCTGG + Intronic
1137270738 16:46900850-46900872 CAGGACCCTCCGCTTGAGGCTGG - Intronic
1137763241 16:50957661-50957683 CTGCTTCCTCCTGATGATGCAGG + Intergenic
1139356183 16:66368243-66368265 CTGGTCCATCCTCAGGTGGTGGG + Intronic
1140998007 16:80279750-80279772 CTGGTGCCTCCTCTTGGGTCTGG - Intergenic
1141141275 16:81498330-81498352 CTGGACCGTCCTCAGGAAGCTGG - Intronic
1142411786 16:89920746-89920768 CTGGTCCCTTGGCCTGAGGCAGG - Exonic
1143303362 17:5927468-5927490 CTGGTTCATCAACATGAGGCTGG - Intronic
1143747721 17:9005799-9005821 CTGGCCTCTCCTCATCTGGCTGG - Intergenic
1146057393 17:29588355-29588377 CTGCTCCCTTCTGATGAGGGAGG - Intronic
1147285676 17:39401388-39401410 CACGTCCCTCCTCATGGGGCCGG + Exonic
1147782513 17:42953842-42953864 CTGGCCCCTCCTTCTGAGGCTGG + Intronic
1147870322 17:43582549-43582571 CTGGTCCCTCCTACAGAGGCTGG - Intergenic
1147892241 17:43725559-43725581 CTGAGCCCTCCTCCTGAGCCAGG + Intergenic
1148087647 17:45004091-45004113 CTGGTGCCTCAGCATGAGGCCGG + Intergenic
1148820041 17:50354951-50354973 CAGGTACATCCTCAGGAGGCTGG - Exonic
1150227342 17:63531176-63531198 GCTGTCCCTTCTCATGAGGCCGG + Intronic
1151725460 17:75881290-75881312 CAGCTCCCTCCCCAAGAGGCTGG - Intronic
1151983142 17:77526185-77526207 CAGCTGCCTCCCCATGAGGCAGG - Intergenic
1152986087 18:322677-322699 CCAGACCCTCCACATGAGGCAGG - Intronic
1153483957 18:5576387-5576409 CTCGTCCCTCAGGATGAGGCAGG + Intronic
1156407213 18:36794319-36794341 CTGCTCACTCCTTCTGAGGCAGG + Intronic
1157016306 18:43719494-43719516 CCCATCCCTCCTCATGGGGCAGG + Intergenic
1157985928 18:52437274-52437296 CTGAACCCTCCACATCAGGCAGG - Intronic
1160892645 19:1387413-1387435 CTGGCCCCTTCTCATGAGGCAGG - Intronic
1161107743 19:2453053-2453075 CTGGGTCATCCTCATGGGGCTGG + Intronic
1161302154 19:3547934-3547956 CTGGCTCCTCCGCATGCGGCCGG + Exonic
1161327933 19:3672376-3672398 CTGGTCCCTCCTGCTGAGCCTGG + Intronic
1161762682 19:6185856-6185878 CAGGTCCATCCTCCTGAGGGTGG - Intronic
1161792496 19:6368727-6368749 CTGGCCCCTCCACATGATTCTGG - Exonic
1164430680 19:28185852-28185874 CAGCCTCCTCCTCATGAGGCTGG - Intergenic
1165438920 19:35812749-35812771 CTGGTCCCCCCTCCAGGGGCTGG - Exonic
1166665895 19:44680313-44680335 TTGGGCCCTGCTCATGATGCTGG + Exonic
1168097707 19:54124911-54124933 CTCGTCCCAACTCATGAAGCAGG - Intronic
1168284214 19:55322398-55322420 CTGGGCCCTCCCCAAGGGGCTGG - Intronic
926428477 2:12762175-12762197 CTGGCCCCTTCTCTGGAGGCAGG - Intergenic
927640236 2:24841278-24841300 CTGCTCCATCCTCATGGGGCTGG - Exonic
927721839 2:25388034-25388056 CTGGCCCCTTCTCATGAGACGGG - Intronic
928822314 2:35376352-35376374 ATGGTCCATCTTCATGAGTCAGG - Intergenic
929965062 2:46528549-46528571 CTTCTCCCGCCTCATGAGGGTGG + Intronic
931434166 2:62232706-62232728 CTGGTCCCTCCTCCAGAAGTTGG + Intergenic
931670562 2:64643430-64643452 CCGGTGACTCATCATGAGGCAGG - Intronic
932128469 2:69166699-69166721 TTTGTCCCTCCTAATGAGGAAGG + Intronic
932811694 2:74831576-74831598 CAGATACCTCCTCATGATGCAGG - Intergenic
935784783 2:106538843-106538865 CTTGCCCTTCCTCATCAGGCCGG + Intergenic
936370329 2:111898154-111898176 CTGGACCCTCCTCTTGGGTCTGG + Intergenic
937044502 2:118844015-118844037 CTGATCCATCCTCATGACCCTGG + Intronic
937885646 2:126898215-126898237 CTTGTCACTCCTCAGGGGGCAGG - Intergenic
938695845 2:133834774-133834796 CTGGTCCCGCCTCTAGAGGTAGG + Intergenic
941651141 2:168093980-168094002 CTGGTCCCTCCACCTGAGATGGG + Intronic
1169217487 20:3801989-3802011 CCGGCCCATCCTCAAGAGGCTGG + Exonic
1171962224 20:31503190-31503212 CTGCTGCCTCCCCATGAGCCAGG + Intergenic
1172760610 20:37318612-37318634 CTGGTTCCTCCTCTTGAGAGGGG + Intergenic
1173730642 20:45325974-45325996 CTGGTGCCTTCTGATGGGGCTGG - Exonic
1174413694 20:50353077-50353099 CCGGTTCCTGCGCATGAGGCGGG + Intergenic
1175440468 20:58987380-58987402 CTGCTCCCTCCTCACTGGGCAGG + Intronic
1175840009 20:62020639-62020661 CTGGGCCTTCCTCAGGTGGCTGG - Intronic
1176636038 21:9195536-9195558 CTGGTCCCACCTCATTAAGATGG - Intergenic
1180143412 21:45906644-45906666 CTACACCCACCTCATGAGGCAGG + Intronic
1182423916 22:30262110-30262132 ATGCTCACTCCACATGAGGCAGG + Intergenic
1184805558 22:46792947-46792969 CTGGCCCCTCCACAGCAGGCGGG + Intronic
1184908583 22:47509697-47509719 CTGGTGACTCTTCATGAAGCAGG + Intergenic
1185262910 22:49880110-49880132 CCGTTTCCTCCTCTTGAGGCTGG + Intronic
1185367537 22:50443791-50443813 CTGGTCCTTGGGCATGAGGCGGG + Intronic
952863039 3:37830695-37830717 CTGGTCCTTCCTCACCATGCTGG - Intergenic
954038639 3:47867685-47867707 CTGCTCCCTCCTCAAGAGCTGGG + Intronic
954111570 3:48436508-48436530 CTGGGCCCCCTTCATAAGGCTGG + Intronic
961519834 3:127460657-127460679 CTGGTCCCTCTGAATGAGCCAGG + Intergenic
962367908 3:134797874-134797896 CTGGTCCCTACTCAGTACGCAGG + Intronic
966872475 3:184299742-184299764 CTGGCCCCTCCTAAGGAGGCAGG + Intronic
967152747 3:186664751-186664773 CTGGTCCCTTCTGATGCTGCTGG + Intronic
967407915 3:189138030-189138052 TGTGTCCCTCCTCTTGAGGCAGG - Intronic
968129325 3:196183532-196183554 CTGGACCTTCCTACTGAGGCAGG - Intergenic
971209837 4:24605251-24605273 CTGGTGCCTCAGTATGAGGCTGG - Intergenic
972720423 4:41691280-41691302 CTGGTCCCCCTGCAAGAGGCTGG + Intronic
973840337 4:54854528-54854550 CTGGTGACCCCTTATGAGGCAGG - Intergenic
977883616 4:102234561-102234583 CAGCTGCCTCCCCATGAGGCAGG + Intergenic
978508826 4:109493086-109493108 CTTGTCCCTCCTCATGGTGATGG - Intronic
984529098 4:180894310-180894332 CTGAGCCCTCCTCATCTGGCTGG + Intergenic
986191471 5:5500324-5500346 CTGCTCCTTCCTCAGGACGCTGG - Intergenic
993042464 5:82830565-82830587 CAGGTCCCTGCTCTGGAGGCTGG + Intergenic
1000197919 5:158977847-158977869 CTCCTCCCTCCTCCTAAGGCAGG - Intronic
1002170686 5:177372424-177372446 CCGGCCCCTCCTCAGGAAGCTGG + Exonic
1006788314 6:36682602-36682624 CTGCTGAGTCCTCATGAGGCAGG - Intronic
1006803961 6:36776787-36776809 CTTGTCCCTCCTCCTGTGGCTGG + Intronic
1007229515 6:40338540-40338562 CTGTTCCCTGCTCAGGAGGCTGG + Intergenic
1007386344 6:41522828-41522850 TTGGCCCCTCTTCATGAGCCAGG + Intergenic
1007397229 6:41584913-41584935 CTGGTCCCTCCTCCTCTGCCTGG + Intronic
1007789239 6:44299585-44299607 CTGTTTCCTCCACATGAAGCAGG + Intronic
1010609039 6:77929946-77929968 CTGTTCCCTCCTCATGTGTCAGG - Intergenic
1011410314 6:87059930-87059952 CAGCTGCCTCCTCATGGGGCAGG - Intergenic
1012409425 6:98938988-98939010 CTGTTTCCACCTCAGGAGGCTGG + Intronic
1012974530 6:105765876-105765898 CTGTTTCCTCCTAATGAGGAGGG + Intergenic
1016546627 6:145231625-145231647 CTGGTCCCTTCCCATGAGTGAGG - Intergenic
1017024132 6:150166704-150166726 CTGCTTCCTCCTCCTGAGGCAGG - Intronic
1018652612 6:166004784-166004806 CTGGTCCCTCCTCTTGACTATGG + Intergenic
1019341739 7:511764-511786 CTAGTTCCTCCTCAGGGGGCTGG + Intronic
1019934895 7:4247760-4247782 CTGGCCCCACCTCATGGGGCTGG - Intronic
1021215732 7:17913207-17913229 GTGGTCCCTCCTTTTGTGGCTGG - Intronic
1021542034 7:21770541-21770563 CTGGTCCCTCCTCATGAGGCTGG - Intronic
1021970712 7:25963094-25963116 ATGGTGCCTCCCCATGAGACTGG + Intergenic
1023792423 7:43763418-43763440 GTGGTCCCTCCTCAGCAGGCAGG - Intronic
1024655499 7:51448269-51448291 CTGGTCTGTCCTCCTGAGGGTGG - Intergenic
1026764588 7:73152493-73152515 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027041058 7:74962261-74962283 GTGGTGCCTTCTCCTGAGGCAGG - Intergenic
1027082579 7:75240112-75240134 GTGGTGCCTTCTCCTGAGGCAGG + Intergenic
1029610137 7:101622383-101622405 TTGCTCCCTTCTCATGAGGCTGG - Intronic
1032486678 7:132292889-132292911 CTGGTCCCTCCTCATGCCTGTGG - Intronic
1034074741 7:148220931-148220953 CAGGTCCCTCCCCAGGAGGAGGG + Intronic
1034255155 7:149720715-149720737 CTGGCTGCTCCTCATGTGGCTGG + Intronic
1034527970 7:151678104-151678126 CTGCTCCATCCTCATGGGGAAGG + Intronic
1034527971 7:151678109-151678131 CAGGTCCTTCCCCATGAGGATGG - Intronic
1034970998 7:155419037-155419059 CTGCTCCCTCCTCAGCAGCCAGG - Intergenic
1035087758 7:156275823-156275845 CTGGTCCCTCCTCATTCTTCAGG + Intergenic
1037783615 8:21888652-21888674 CTGCTGCCTCTGCATGAGGCCGG + Intergenic
1039954312 8:42195429-42195451 CTGTTCCCTCCTGATGGGACAGG - Intronic
1041601203 8:59719031-59719053 CTGCTGCCTCCTGATGTGGCAGG - Intergenic
1043037278 8:75213981-75214003 CCGGTCCCTCCACATGTGCCTGG - Intergenic
1047260511 8:123254739-123254761 CTGGTCCTTACTCAAGTGGCTGG - Exonic
1047982407 8:130196906-130196928 CTGGTGCCTCCTGAAGTGGCAGG + Intronic
1048439242 8:134447800-134447822 CAGGTGCCTCTTCAGGAGGCTGG - Intergenic
1048507403 8:135033897-135033919 CTGTGTCCTCCTCATGGGGCAGG + Intergenic
1049308330 8:141919959-141919981 CTGGGCCCTCCTCAAGACCCAGG - Intergenic
1054831491 9:69630284-69630306 CTGGTCCCTGCCCATGTTGCTGG - Intronic
1055632171 9:78235991-78236013 CAGGTCCCGCCTCCTGAGGACGG - Intergenic
1057476715 9:95409154-95409176 CTGGTTCCTCCTCAGGAGGAGGG + Intergenic
1060960120 9:127674830-127674852 CTGGCCCCGCTTCATGATGCAGG - Intronic
1061067571 9:128288156-128288178 CTGGTCCTTTCTCCTGAGGAAGG - Intronic
1061538873 9:131266599-131266621 CTGGACCCTCCACATGGGCCAGG + Intronic
1185691849 X:2161937-2161959 CTGGTCCATCCTAATGAGCACGG + Intergenic
1185894085 X:3843235-3843257 CAGGGCCCTCCCCAGGAGGCGGG + Intronic
1185899203 X:3881659-3881681 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1185904320 X:3920088-3920110 CAGGGCCCTCCCCAGGAGGCGGG + Intergenic
1189299494 X:39942252-39942274 CTGGTCCCTCCCTCTGAGGCTGG - Intergenic
1192751783 X:73999405-73999427 CTGGTCCCTCATAATGCAGCTGG - Intergenic
1193805140 X:85985595-85985617 CCCATTCCTCCTCATGAGGCAGG + Intronic
1201434666 Y:13943956-13943978 CTGGTTTCATCTCATGAGGCAGG - Intergenic
1201900141 Y:19040685-19040707 CTGGTCCCTCCTCTAGAGGAAGG - Intergenic