ID: 1021542652

View in Genome Browser
Species Human (GRCh38)
Location 7:21777049-21777071
Sequence GTGGTTATAAAATGGCAACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 1, 2: 7, 3: 35, 4: 228}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021542652_1021542664 27 Left 1021542652 7:21777049-21777071 CCATGTTGCCATTTTATAACCAC 0: 1
1: 1
2: 7
3: 35
4: 228
Right 1021542664 7:21777099-21777121 ACCTCCTGAATCCTAGTTCCTGG 0: 1
1: 1
2: 3
3: 33
4: 215

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021542652 Original CRISPR GTGGTTATAAAATGGCAACA TGG (reversed) Intronic
903772677 1:25773891-25773913 GTGATTTTAACATGGCAACAAGG - Intronic
904298147 1:29536752-29536774 GCTTTTATAAAATGGCATCATGG + Intergenic
908408801 1:63842838-63842860 GTGGTTAGAAGTTGGCAGCATGG + Intronic
909193864 1:72591301-72591323 GTGGTTAAAAAAAGTCAACTTGG + Intergenic
909809136 1:79908674-79908696 ATGTTTATAAAATAGCCACAGGG - Intergenic
910055642 1:83030731-83030753 GTGATTAAAAAATGGTAGCATGG - Intergenic
911894770 1:103418417-103418439 GTGGTTGTAACAAGGGAACATGG - Intergenic
912304539 1:108553991-108554013 CTGGTTATAAATTGCCAATAGGG + Intergenic
913324286 1:117613164-117613186 GTGGTTACCAAGTAGCAACAAGG + Intronic
915580556 1:156810395-156810417 GTGGTTCTGAAAATGCAACATGG + Intronic
915842102 1:159222120-159222142 GAGGTGATAAAATGGAAACATGG - Intergenic
915864561 1:159485284-159485306 GTGATTATAAAAAGGGACCATGG + Intergenic
916155872 1:161847035-161847057 GTCATTATTAAATTGCAACAAGG - Intronic
916394171 1:164367251-164367273 ATGTTTACAAAATGGCAAAAGGG + Intergenic
916799689 1:168204785-168204807 GTGGGTAAAAAAGGGCAAAATGG + Intergenic
919891013 1:201974618-201974640 TTGGCTATAAAAAGGCAGCATGG - Intergenic
920592717 1:207236663-207236685 TGCGTTATAAAAAGGCAACATGG + Intergenic
920875950 1:209836000-209836022 ATGGTTATAAAAGGGCAACAAGG - Intronic
921375995 1:214474463-214474485 TAGGATAAAAAATGGCAACAAGG + Intronic
924235202 1:241994333-241994355 GTGGTTAGAAGTTGGCAGCATGG - Intergenic
1062886324 10:1019257-1019279 GTGCTTATAAAATGGAAATTGGG + Exonic
1063032389 10:2248406-2248428 CTGGTTATAAAATGGTAAACTGG - Intergenic
1063607768 10:7537814-7537836 GTGAGCATAAAATGGCAGCAAGG - Intergenic
1063650327 10:7929799-7929821 GTGGTTCTAAAGTGGTAAGATGG + Intronic
1064167935 10:13002242-13002264 GTGTTTAGAAAATGGAATCAGGG - Intronic
1064454954 10:15478644-15478666 GAGTTAATAAAATGGCACCACGG + Intergenic
1064490396 10:15849889-15849911 GTGGTAAGAAAATTGAAACAGGG - Intronic
1067266578 10:44750735-44750757 GTGGTTATAAAAGGGCCACAAGG + Intergenic
1070476492 10:76834348-76834370 CTGGTTAGAAAATCGCAACAAGG + Intergenic
1072505392 10:96061554-96061576 TTGGTTATAAACTTGCCACATGG - Intergenic
1072545818 10:96437515-96437537 ATTGTTATAAAATAACAACATGG - Intronic
1073555953 10:104451647-104451669 GTGCTCATAAAATGTCAACATGG + Intronic
1075109339 10:119565277-119565299 GTGGTTACAAAATGGAAAATTGG - Intergenic
1075801411 10:125156348-125156370 GTGGTAAAAAAATGACAACTGGG + Intronic
1078314672 11:10284381-10284403 GTGGTTATAAAAGGGTAATTGGG - Intronic
1078793043 11:14564160-14564182 ATGATTATAAAAGGGCAGCATGG - Intronic
1079040268 11:17053026-17053048 GTGGGTTTAAAAAGGCAGCAAGG + Intergenic
1079917725 11:26391428-26391450 TTGGTTATTAAATTTCAACATGG + Intronic
1080119189 11:28656768-28656790 GTGTTTATAGAATGGCACTAAGG + Intergenic
1080672920 11:34397520-34397542 CTGGTGATAAAATGAAAACACGG - Intergenic
1081184410 11:40024550-40024572 GAGGATATAAAATGGCATCCTGG - Intergenic
1081570455 11:44287401-44287423 GGGGCTATAAAATGGAAACCTGG - Intronic
1083155177 11:60818440-60818462 GTAGTGAGAAAGTGGCAACAGGG + Intergenic
1083806312 11:65076413-65076435 GTTGTTAAAAAATGACAACCAGG - Intronic
1086061902 11:82708464-82708486 GTCCTTCCAAAATGGCAACATGG + Intergenic
1086176216 11:83894142-83894164 GTGGTTACAAGAAGGCAACAAGG - Intronic
1086377871 11:86219629-86219651 ATGGTCATACAATGTCAACATGG - Intergenic
1087971052 11:104484622-104484644 GTGGTTCTCAAATTGCAATAGGG - Intergenic
1089006121 11:115092099-115092121 TTGACTAGAAAATGGCAACAGGG - Intergenic
1090214288 11:124947263-124947285 GAGGTCAGAAAATGGGAACAGGG + Intergenic
1090519577 11:127464075-127464097 GAGGTTTGAAAATGGAAACAGGG + Intergenic
1093406999 12:18816617-18816639 GTGGTTATAAAATGGCATCCTGG + Intergenic
1094342184 12:29424945-29424967 GTGGTCATGAGAAGGCAACATGG + Intronic
1096714571 12:53483310-53483332 GTGGTTCCAATATGGCAAGAGGG - Intronic
1097989743 12:65823068-65823090 ATGGATTTAAAATGGCAACGCGG + Intergenic
1098462266 12:70744737-70744759 GGGGTTAGAAAATGGAGACATGG + Intronic
1099145488 12:79038608-79038630 GTGGTTAGAAAATAGTTACAAGG - Intronic
1099756934 12:86863647-86863669 GTGGGTATCAAAAGGCCACATGG + Intergenic
1100396108 12:94187738-94187760 GTGGTGATTAAATAGCCACATGG + Intronic
1100503265 12:95194622-95194644 GTGGGTATAAAAGGACAAGAGGG + Intronic
1100503379 12:95195788-95195810 GTGGGTATAAAAGGACAAGAGGG + Intronic
1102931375 12:116865001-116865023 GTGGATGAAAAATGGAAACAGGG - Intronic
1106232958 13:27836088-27836110 GTGGCTATAAAAGGGCATCAGGG - Intergenic
1106480698 13:30135108-30135130 GTGGTCAAAACAGGGCAACATGG + Intergenic
1106626468 13:31425603-31425625 CTGGTTATCACATGACAACAAGG + Intergenic
1106650186 13:31682079-31682101 GTAATTATAAAAAGTCAACATGG - Intergenic
1108441905 13:50462739-50462761 GTGGCTATAAAAGGGCACCACGG + Intronic
1111733904 13:92113059-92113081 GTCATTATGAAATGGCAACATGG + Intronic
1112150329 13:96753211-96753233 ATGTATATAAAAAGGCAACAAGG - Intronic
1113563462 13:111302655-111302677 GTGGTTATAAATGGACAAAAAGG + Intronic
1114037207 14:18640835-18640857 GTGGTTCTAAAATGGCAGCCAGG + Intergenic
1114121434 14:19674208-19674230 GTGGTTCTAAAATGGCAGCCAGG - Intergenic
1114837540 14:26221096-26221118 GTGGTAATGGAATGGCAATATGG + Intergenic
1115632488 14:35259180-35259202 GACGTTATATAATGGTAACAGGG - Intronic
1116188496 14:41631786-41631808 ATGGTTATAAAATAGCCAAAGGG + Intronic
1116939986 14:50781716-50781738 CTGCCTATAAAATGGGAACAAGG + Intronic
1118904503 14:70013821-70013843 ATGGTTATATCATGGGAACAGGG + Intronic
1120145523 14:80974526-80974548 GTGGTTGTGAAATGGCAATTTGG - Intronic
1120166060 14:81201693-81201715 GTGATTATAAAATAGCCTCATGG - Intronic
1120633357 14:86919828-86919850 CTGGCTATAAAAGGGAAACAAGG - Intronic
1120761137 14:88286425-88286447 CTGCTCATAAAATGGAAACATGG + Intronic
1121170264 14:91847957-91847979 GTGGTTGTAGAATGGCTACCAGG + Intronic
1121227464 14:92331650-92331672 ATGGTTTTAAAATGCAAACAAGG - Intronic
1124051869 15:26204127-26204149 GGGTTTATAAGATGGAAACAGGG + Intergenic
1126318334 15:47394938-47394960 TTTGGTATAAAATGACAACAGGG - Intronic
1126804617 15:52334623-52334645 ATATTTATAACATGGCAACATGG - Intronic
1127657083 15:61065794-61065816 GGGGTTATGCAATGGAAACAAGG - Intronic
1127787983 15:62372978-62373000 TAGGTTATAAAAAGGCACCATGG + Intergenic
1129479925 15:75815562-75815584 GAGGTTGTAAAATGTCCACATGG + Intergenic
1130008174 15:80123444-80123466 GTGGAAATAACATGGTAACAAGG + Intronic
1131357701 15:91759980-91760002 GTGTATATAAAATTTCAACAAGG + Intergenic
1132832755 16:1937187-1937209 GTGGGTATAAATTGGGAAAATGG + Intergenic
1138780734 16:59782037-59782059 TTGGGTATAAAATGACAGCAGGG + Intergenic
1140587409 16:76309570-76309592 CTGGTTCTAAATTGGAAACATGG + Intronic
1140861993 16:79026100-79026122 GTGTTTTGAAAAGGGCAACAGGG - Intronic
1143062748 17:4216419-4216441 GTTGTTCTAAAATGCCAACTTGG + Intronic
1144722577 17:17482015-17482037 ATGGATATGAAATGGAAACAGGG + Intronic
1146957682 17:36946315-36946337 GTGGCTTTAAGATGGCCACAGGG - Intergenic
1147704744 17:42418531-42418553 GTGGGGATAAAATGGAAATACGG - Intronic
1148513647 17:48195385-48195407 GTGGATATCAAATGGAACCACGG - Intronic
1149642810 17:58215151-58215173 GTGGTTAGAAAATGCCAAATGGG + Intronic
1153613076 18:6907679-6907701 GTGGCTATAAAGAGGCAACAGGG + Intronic
1155858561 18:30866998-30867020 TTCATTAAAAAATGGCAACAAGG + Intergenic
1156107885 18:33687980-33688002 GGGTTTAGAAAATGTCAACAAGG - Intronic
1156157809 18:34324250-34324272 GTTGTTATAAAATGTCACCTTGG + Intergenic
1156792559 18:40993615-40993637 ATGCATATAAAATGGCAACATGG - Intergenic
1156890978 18:42189025-42189047 TTGATTATAAAATGGCAAAGGGG - Intergenic
1159031060 18:63232834-63232856 CTGTTTATAAAATGACAACCTGG + Intronic
1159041667 18:63329254-63329276 GGGGTTTTAAAAAGGCAATATGG + Exonic
1160253936 18:77231066-77231088 TTTGTTACAAAATGTCAACATGG + Intergenic
1161390550 19:4018312-4018334 GTGGTTATAAAATAGCAGCCAGG - Intronic
1161521810 19:4728725-4728747 GTCCTTATAAAAAGGGAACATGG - Intergenic
1164519169 19:28964646-28964668 GTGGCTATGAAAGGGCAGCAGGG + Intergenic
1168655763 19:58126444-58126466 ATGTTTATAATATGGCAAAAAGG - Exonic
925676889 2:6372131-6372153 GAGGTTATAAAATTGTCACAAGG - Intergenic
929011399 2:37448792-37448814 GTGGTTCTTAAATGGAAAGAAGG - Intergenic
930456069 2:51608975-51608997 ATGGTTATATCATGGCAACAGGG - Intergenic
930533330 2:52616754-52616776 GTGAATATTAAATGGAAACATGG - Intergenic
931177670 2:59870127-59870149 GTGGCTGAAAAATGGAAACAGGG - Intergenic
933369325 2:81395448-81395470 GGGGAAATAAAATGTCAACAGGG - Intergenic
935126315 2:100226597-100226619 GTGGCTATAAAACATCAACAGGG - Intergenic
936104326 2:109612328-109612350 GTGGTTATAAAAAGGCATTAAGG + Intronic
937702044 2:124873698-124873720 ATGGTATTAAAATGGCTACATGG + Intronic
938224947 2:129607443-129607465 GTGGTGATAAACTGGACACATGG + Intergenic
938273781 2:129998228-129998250 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938278134 2:130045760-130045782 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938329104 2:130436561-130436583 GTGGTTCTAAAATGGCACCCAGG - Intergenic
938360841 2:130684932-130684954 GTGGTTCTAAAATGGCACCCAGG + Intergenic
938437245 2:131291625-131291647 GTGGTTCTAAAATGGCACCCAGG + Intronic
938442427 2:131347887-131347909 GTGGTTCTAAAATGGCACCCAGG + Intronic
938983692 2:136551802-136551824 GCAGTTTTAAAAGGGCAACATGG - Intergenic
939755751 2:146107480-146107502 GTGGTTATAACATGTAAGCACGG - Intergenic
940930703 2:159426603-159426625 GTAGTTCTAAAATGTCAAAATGG - Intronic
942327204 2:174786010-174786032 GTGGACAAAAACTGGCAACAAGG - Intergenic
942469858 2:176248991-176249013 GCAGTTATAAAATGGCTGCAAGG + Intergenic
943068418 2:183113391-183113413 GGGGTTATAAAAGGGCAACATGG + Intergenic
943492008 2:188566378-188566400 GTTATTATAAAATGAGAACATGG + Intronic
943565176 2:189508613-189508635 GTGGTTACAAAAAGGCAACAAGG + Intergenic
945617429 2:212089956-212089978 GTGCTTATAAAATGTCTACCAGG + Intronic
945994275 2:216422697-216422719 GTGGTCAGAAAAAGGCATCATGG - Intronic
947330741 2:229026884-229026906 GTGTTTATAATATGCCAAGAAGG + Intronic
1170090156 20:12581816-12581838 TTGGTTATAAAATGTTAACTGGG + Intergenic
1173384285 20:42573711-42573733 GTGGTCTCAAAATGGCAAGACGG + Intronic
1176729157 21:10473339-10473361 TTGGTTATAGAAAGGCTACAAGG + Intergenic
1178158903 21:29888113-29888135 GGGGCTATAAAATGGAGACAAGG - Intronic
1179024070 21:37666011-37666033 GTGGGTATGAAATGACATCATGG - Intronic
1180461330 22:15567883-15567905 GTGGTTCTAAAATGGCAGCCAGG + Intergenic
1180911997 22:19457268-19457290 ATGGTTATAAAAAGACAACATGG - Intronic
949655746 3:6216840-6216862 GTGTTTCTTAAATGGCAACTTGG + Intergenic
950180091 3:10905661-10905683 GTGGTTGTGAAAATGCAACATGG - Intronic
950578710 3:13849105-13849127 GTGGCTATACAAGGGCAACCTGG + Intronic
951129576 3:19025807-19025829 ATGGCTCAAAAATGGCAACATGG - Intergenic
951273258 3:20653804-20653826 GTGGCTATATAATGTCATCAAGG + Intergenic
951417117 3:22438401-22438423 CTGATTATAAAATGGGAAAAAGG - Intergenic
951752296 3:26050628-26050650 GTGGTTTTAAAATGCCAAGTAGG - Intergenic
952594627 3:35001125-35001147 GTGGTTATAAAAAGACAATGAGG + Intergenic
954834844 3:53457022-53457044 GTAGTTATAAAAACGGAACATGG + Intergenic
955678986 3:61480613-61480635 TTGGGCACAAAATGGCAACAGGG - Intergenic
956021233 3:64935267-64935289 GTGGTGATAAGATGACAATAAGG + Intergenic
956483998 3:69702175-69702197 GTCGTTATAAAATGTCAGCTGGG + Intergenic
957485737 3:80860209-80860231 GTTGTTATATAATGGTAAAAGGG + Intergenic
961335028 3:126170675-126170697 ATGGTTATAAAAGGACAAGAGGG - Intronic
961913310 3:130344118-130344140 CTGCTTATAAAATTGAAACAAGG - Intergenic
962561352 3:136609919-136609941 AAGCATATAAAATGGCAACATGG + Intronic
963016055 3:140825107-140825129 GTGTTTATTAAATGCCAACTAGG + Intergenic
964481681 3:157145034-157145056 TTTGTTTTAAAATGGGAACATGG + Intergenic
965311687 3:167136120-167136142 CTGGTCAAAATATGGCAACAGGG + Intergenic
965606891 3:170506760-170506782 CTGGTTCTAAAAGGGCAATAGGG - Intronic
966009539 3:175057523-175057545 GGGCTTATAAACTGTCAACAGGG - Intronic
966014121 3:175120210-175120232 ATGGTTGTAAAATGTCTACATGG - Intronic
966273456 3:178136652-178136674 ATCATTATAAAATGGAAACAAGG + Intergenic
966558390 3:181290059-181290081 TTGCTTATAAAATACCAACAGGG + Intergenic
967164729 3:186770471-186770493 GTGGCTATTAAAGGGCAACATGG - Intergenic
970062325 4:12049317-12049339 ATGCTGATAAAATGGCAACCTGG + Intergenic
972494302 4:39618925-39618947 TTGGGCATAAAATGGCAGCAGGG + Intronic
972732255 4:41806527-41806549 GTGCTAGTAAAATGACAACATGG + Intergenic
975495937 4:75036028-75036050 TTTGTTATAAAATGGAAACGAGG - Intronic
975649903 4:76582589-76582611 GGGCTTATAAAATGGCAATTAGG + Intronic
977728554 4:100325334-100325356 TTGGCTAGAAATTGGCAACATGG - Intergenic
978986479 4:115019678-115019700 ATGGTAATTAAATTGCAACATGG - Intronic
979523999 4:121698136-121698158 GGGGTTATTAAAGGTCAACATGG + Intergenic
982635935 4:157896728-157896750 ATGAATAAAAAATGGCAACAAGG - Intergenic
985219857 4:187692757-187692779 GTTGTTTAAAAATAGCAACAAGG + Intergenic
989134313 5:38137597-38137619 GTGGTTAAAACCTGGCTACATGG + Intergenic
993699151 5:91097770-91097792 GTGGGTATGAAATGGTATCACGG + Intronic
994035019 5:95188699-95188721 GTGGTTATTAAAGGGCAATGCGG + Intronic
996811909 5:127525077-127525099 AAGGTTATAAAATTGCGACAAGG - Intronic
996851331 5:127956627-127956649 ATGTTTATAAAAGGGCAACATGG + Intergenic
996942908 5:129030925-129030947 ATGGTTGTAAAAGGACAACATGG - Intronic
997676744 5:135718858-135718880 GTGGTTATCAAAGGGCAAGGGGG + Intergenic
999617702 5:153442495-153442517 GTGATTATGAAATGTCACCATGG - Intergenic
1000125917 5:158243900-158243922 GTGGTTATCAAATGGGGAGAAGG - Intergenic
1000323305 5:160152218-160152240 GTGGTTATGAAAGAGCAACATGG - Intergenic
1000664825 5:163981920-163981942 GTGGGTATAAAATGAAAACATGG - Intergenic
1001164793 5:169354291-169354313 GTGGTTATAAAAAGGCAACAGGG + Intergenic
1003036106 6:2641695-2641717 ATGGTTTTAAAAAGGCAAAAAGG - Intergenic
1003077905 6:2999198-2999220 GTGGCTATAAAAACGCAACCCGG - Intronic
1003085148 6:3054566-3054588 GTGGCTATAAAAACGCAACCCGG + Intergenic
1004198983 6:13530719-13530741 GTGGTTCAAAAATGTCAACAAGG + Intergenic
1005244733 6:23869933-23869955 GTGGCTATAAAAGGGAAACAGGG + Intergenic
1006093637 6:31642744-31642766 GTGGTTATATAATGGCAAGAAGG + Intronic
1006272552 6:32975157-32975179 GTGGTTAGAGAAAGGCAGCAGGG + Intronic
1007970277 6:46045093-46045115 GTGGTATTAAAAATGCAACAGGG - Intronic
1010138780 6:72587872-72587894 GTAGTTATAAAAGGGCAAAATGG - Intergenic
1010235370 6:73570918-73570940 GTTGCTGAAAAATGGCAACATGG - Intergenic
1011860527 6:91749449-91749471 GTGCTTATAATTTGGCAAAATGG + Intergenic
1012075939 6:94686521-94686543 GTCTTTTTAAAATGTCAACATGG - Intergenic
1014975351 6:127874735-127874757 ATGGCTATAAAAAAGCAACATGG + Intronic
1015878343 6:137846322-137846344 GTGGTTATCAAATGGTACGAGGG + Intergenic
1015946122 6:138503038-138503060 GTGGATATAAATTGGAAGCAGGG - Intronic
1017543746 6:155428979-155429001 GTGGCTTTAAAATGGCGCCAGGG - Exonic
1017574035 6:155781410-155781432 ATGTTTATAAAATGGAAATAGGG - Intergenic
1017808929 6:157969977-157969999 GGTTTTATAAAATGGCAACAAGG + Intergenic
1018445339 6:163853107-163853129 ATGTTAGTAAAATGGCAACATGG - Intergenic
1019349389 7:546784-546806 GTGGCTATAAAAAGGCAGCTGGG - Intergenic
1020995445 7:15258069-15258091 GTTGTTATAAGATGGCAATCCGG - Intronic
1021304686 7:19017902-19017924 ATGGTAATAAAAAGGGAACAGGG + Intergenic
1021313539 7:19118549-19118571 GTGGGGATGAAATGGCCACAGGG - Intergenic
1021542652 7:21777049-21777071 GTGGTTATAAAATGGCAACATGG - Intronic
1021675709 7:23078892-23078914 GTGATTGTAAAATGGCAAGTTGG - Intergenic
1021900320 7:25278964-25278986 GCGGTTGCAAAATGGCAACCTGG + Intergenic
1024600156 7:50973532-50973554 GTAGTGATAAAAAGGAAACAAGG - Intergenic
1025620506 7:63165972-63165994 GTGATTCTAAAATGAAAACAGGG - Intergenic
1026188224 7:68100800-68100822 GTGATTCTAAAATGAAAACAGGG - Intergenic
1026627219 7:72005823-72005845 GTTGTCATTAAAGGGCAACAGGG + Intronic
1026644308 7:72154590-72154612 GTGGTTATATCAGGGCAAAAAGG - Intronic
1027478160 7:78659661-78659683 GTGGCTATAAAAGGACAACATGG + Intronic
1032332381 7:130992494-130992516 GTATTTATAAAATGGAAAAAAGG + Intergenic
1034081290 7:148280003-148280025 GTGGTTAGAAAAGGAAAACAAGG + Intronic
1034177036 7:149108244-149108266 GAGATTAAAAAATGCCAACATGG - Intronic
1034600430 7:152248269-152248291 TTGGTTATAGAAAGGCTACAAGG - Exonic
1038405597 8:27320185-27320207 GAGGGAAAAAAATGGCAACAGGG - Intronic
1039146434 8:34451999-34452021 GTGGTTCTAAAATAGCCAGATGG + Intergenic
1039326761 8:36493784-36493806 ATGGTCATTAAATGCCAACATGG + Intergenic
1040098528 8:43474695-43474717 GTGGATGTTAAATGGCTACAAGG + Intergenic
1040518207 8:48151610-48151632 GTGATGATAAAATGCCTACATGG - Intergenic
1040943662 8:52858313-52858335 GTGGCTATAAAAGGGGAACTTGG - Intergenic
1041186834 8:55309442-55309464 GTCATTATAAAAGGGCAATATGG + Intronic
1041768142 8:61442048-61442070 GTGCCTATAAAAGGGTAACATGG - Intronic
1042042568 8:64608596-64608618 GTGGTTATAAAAGGGGGAGAGGG + Intronic
1042042582 8:64608638-64608660 GTGGTTATAAAAGGGGGAGAGGG + Intronic
1042112995 8:65401387-65401409 GGGGTAATAAAATGGAACCAAGG - Intergenic
1042722143 8:71837846-71837868 AAGGTGATAAAATGGCAAAAGGG + Intronic
1043220729 8:77660180-77660202 GTGGTGACAAAAGGGTAACAGGG + Intergenic
1043973266 8:86556780-86556802 GTGGTTATAAAAGGGCAACCAGG - Intronic
1045082945 8:98648362-98648384 GTGGTAAAAAACTGGAAACAAGG - Intronic
1046371839 8:113319334-113319356 GAAGCTATAAAATGGCAAAAAGG - Intronic
1046704087 8:117431508-117431530 GTGATTAAAAAATGGAAATAAGG + Intergenic
1050172051 9:2830427-2830449 TGGGTTAGAAAATGTCAACATGG - Intronic
1052726799 9:32238317-32238339 ATGGCTATAAAAGGACAACATGG + Intergenic
1053225340 9:36350287-36350309 GTGGTTAGAAAATGGTGACAAGG - Intronic
1056914660 9:90735619-90735641 GTGGCTATAAAAGGTTAACATGG + Intergenic
1057007481 9:91573365-91573387 GTAGTTGTAAAATGGAAAGATGG + Intronic
1058419183 9:104818557-104818579 GTGGTTTCAACATGGCAAAAGGG + Intronic
1062535969 9:137021247-137021269 GTGGGTATCCAATGGCACCATGG - Intronic
1203585099 Un_KI270746v1:60736-60758 TTGGTTATAGAAAGGCTACAAGG - Intergenic
1185568264 X:1113289-1113311 CTGGTTAGAAAATAGCATCATGG - Intergenic
1186944304 X:14548262-14548284 GTCATTAGAAAATGACAACAGGG + Intronic
1187315706 X:18192836-18192858 GTGGTTATTAAAGAGCAAGATGG + Intronic
1187943233 X:24401841-24401863 GGGGTTAGGAAATGGCACCAAGG + Intergenic
1190451278 X:50583586-50583608 TTCCTTATAATATGGCAACATGG - Intergenic
1191047170 X:56150909-56150931 GTTGTTATAAAATGCTAAAATGG + Intergenic
1192334637 X:70207307-70207329 GTGGGTGTAAAATGGTATCATGG - Intergenic
1193643133 X:84036154-84036176 GTGGCTATAAAAGACCAACATGG - Intergenic
1193754708 X:85394281-85394303 GTGATTATAAAGGAGCAACATGG - Intergenic
1196980986 X:121213424-121213446 CTGGTTCCAAAATGGCAGCATGG - Intergenic
1197546706 X:127834168-127834190 GTGCCTACAAAATGCCAACAAGG - Intergenic
1197627988 X:128824377-128824399 AAGCATATAAAATGGCAACAAGG + Intergenic
1198605290 X:138330893-138330915 GTTGTTACACAATGGTAACAGGG - Intergenic
1199750569 X:150813109-150813131 GTGGTTATAAAATGTAATCATGG + Intronic
1200333870 X:155326946-155326968 GTGGCTTTAAAAGGGCAACACGG + Intronic
1201479059 Y:14417823-14417845 GTACATATAAATTGGCAACAGGG - Intergenic