ID: 1021543395

View in Genome Browser
Species Human (GRCh38)
Location 7:21785998-21786020
Sequence CAGGGCAAACACTTTGAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 209}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021543395_1021543399 13 Left 1021543395 7:21785998-21786020 CCTGCCTCAAAGTGTTTGCCCTG 0: 1
1: 0
2: 1
3: 24
4: 209
Right 1021543399 7:21786034-21786056 ATACTATTAATATCATCTGTTGG 0: 1
1: 0
2: 1
3: 17
4: 218
1021543395_1021543400 25 Left 1021543395 7:21785998-21786020 CCTGCCTCAAAGTGTTTGCCCTG 0: 1
1: 0
2: 1
3: 24
4: 209
Right 1021543400 7:21786046-21786068 TCATCTGTTGGATTAATCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021543395 Original CRISPR CAGGGCAAACACTTTGAGGC AGG (reversed) Intronic
901052775 1:6433794-6433816 CTGGGCAAAGACTTGGAGGAAGG - Intronic
901099403 1:6707839-6707861 CAGGGCAAAGCCTTTGAGGCAGG + Intergenic
901102045 1:6726446-6726468 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
902240366 1:15084256-15084278 CTCGGCAATCACTTTGTGGCAGG + Intronic
903064611 1:20692199-20692221 CAGGGCAAAGGCCTTGGGGCAGG - Intronic
904386674 1:30147137-30147159 CTGGGCACCCACTTTGTGGCAGG + Intergenic
905078438 1:35295327-35295349 AAGGGCAAAGATTATGAGGCAGG + Intronic
906447432 1:45914613-45914635 CAGGGCAAGCAGTTTGACTCAGG - Intronic
906487809 1:46245298-46245320 CAGGGAACAGAGTTTGAGGCAGG - Intergenic
907728588 1:57044021-57044043 AAGGGCAAAAGCCTTGAGGCAGG - Intronic
911253672 1:95609472-95609494 CAGGGCAGTCACTGTGAGACTGG + Intergenic
913268376 1:117067429-117067451 CAGGAGAATCACTTTGAGCCGGG + Intronic
917277196 1:173343408-173343430 AAGTGCAAAGACTCTGAGGCAGG + Intergenic
917669356 1:177257568-177257590 CAGAGCACCCACTCTGAGGCAGG + Intronic
921459032 1:215407182-215407204 CTGGGAAAAAACTTGGAGGCAGG - Intergenic
1064270990 10:13865888-13865910 CAGGGAAGACACTGTGGGGCGGG + Intronic
1064325175 10:14343733-14343755 CAGTGCAAAGGCTCTGAGGCAGG - Intronic
1064502454 10:15989070-15989092 CAGGGTAAACACCAGGAGGCAGG + Intergenic
1065415737 10:25483336-25483358 CAGTGCAAGCGCTTTGAGGTGGG - Intronic
1066247547 10:33598048-33598070 CAGGGGAAAAAAATTGAGGCAGG - Intergenic
1072169367 10:92845323-92845345 CAGGGCAATCACTTTAGGGAAGG + Intronic
1072675741 10:97464789-97464811 CAGGAGAATCACTTTGAGCCCGG - Intronic
1072944364 10:99796589-99796611 CAGGAGAATCACTTTGAAGCCGG + Intronic
1073182812 10:101595661-101595683 CAGGACAAACATTTTAAGACTGG - Intronic
1073361078 10:102899297-102899319 CAGGGCAAACCCTTTCAAGCAGG + Intronic
1074115178 10:110451764-110451786 CAGGGCATGCACTGTGAGGCTGG + Intergenic
1075115574 10:119623843-119623865 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1081633276 11:44703450-44703472 CAGAGCAAACTGTTTGAGCCTGG + Intergenic
1083228504 11:61300087-61300109 CAGGGCAAAGCCTTTGGGGAGGG + Exonic
1083791298 11:64988085-64988107 CAGGACAAGCACTCTGAGGCGGG - Exonic
1085656358 11:78318740-78318762 CAGGGCAATCACTTAAAGGGAGG + Intronic
1085812566 11:79697996-79698018 CAGTGCAAAGATTTTGTGGCTGG + Intergenic
1086503476 11:87478009-87478031 CAGGGCATGCACTGTGAGGTTGG - Intergenic
1087723082 11:101688695-101688717 CTGGGAGAACAGTTTGAGGCTGG - Intronic
1087805235 11:102548136-102548158 AAAAGCAAACACTGTGAGGCCGG - Intergenic
1089982230 11:122781673-122781695 CAGGGCAAAGACATGGTGGCCGG - Intronic
1092173729 12:6389262-6389284 CAGTGCAAAGACCCTGAGGCAGG + Intronic
1092776530 12:11949146-11949168 AAGTGCAAACACCCTGAGGCAGG + Intergenic
1093529091 12:20139627-20139649 CAGGGCCACCACATTGAGCCAGG - Intergenic
1095353606 12:41244601-41244623 CATGGGCAACACTCTGAGGCGGG - Intronic
1096262040 12:50099058-50099080 CAAGGCAGATACTATGAGGCAGG - Exonic
1100008283 12:89921150-89921172 TACAGCAAACACGTTGAGGCTGG - Intergenic
1100040729 12:90314018-90314040 CAGAGCCAACACTTTGAGGGTGG + Intergenic
1100629490 12:96373499-96373521 CAGGGGAATCACTTTGAACCTGG + Intronic
1101725655 12:107386104-107386126 CAGGGCAAAGGCCCTGAGGCAGG - Intronic
1102531510 12:113549912-113549934 AAGAGCAAAGACCTTGAGGCAGG - Intergenic
1102898672 12:116619248-116619270 AAGTGCATACTCTTTGAGGCAGG + Intergenic
1104002864 12:124871505-124871527 CAGGGCAACGACTCTGAGGCAGG + Intronic
1104030122 12:125058943-125058965 CAGGGCTCAGACCTTGAGGCAGG - Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105560286 13:21484303-21484325 CAAGGCAATGACTTTGAGGCAGG + Intergenic
1106814373 13:33390614-33390636 CAGGACACACACTTTGTGTCAGG + Intergenic
1107452429 13:40521988-40522010 AAGGGCAAAAACACTGAGGCAGG - Intergenic
1107477701 13:40755559-40755581 CAGTGCCAACATTCTGAGGCAGG + Intronic
1107954957 13:45502772-45502794 CGGGGCAAAGACTGGGAGGCAGG - Intronic
1108295176 13:49009624-49009646 CAGGGCACACACATTCATGCAGG - Intronic
1109173035 13:59119260-59119282 GAAGACTAACACTTTGAGGCAGG + Intergenic
1110680220 13:78302201-78302223 CAGGGCCATCGCTTTGTGGCTGG - Intergenic
1111681137 13:91443125-91443147 CACTGCAAACATTTTGAGGGTGG + Intronic
1112555277 13:100462010-100462032 CAGAGCAGACACTTTGTGGAGGG + Intronic
1112684096 13:101802946-101802968 CAGTGCATGCACTGTGAGGCTGG + Intronic
1115307047 14:31944308-31944330 CATGGTAAACACTTGGAGGGAGG - Intergenic
1117673807 14:58135175-58135197 CAGGACAAACAATGTGAGTCAGG + Intronic
1117762002 14:59038923-59038945 CTGGGGCAACGCTTTGAGGCAGG - Intergenic
1121564015 14:94895213-94895235 CAGGGCAACAGCCTTGAGGCAGG - Intergenic
1122416660 14:101553043-101553065 TAGGGCAAACACCTTGAGAATGG - Intergenic
1125212466 15:37233235-37233257 CAGGTCAAAGACAGTGAGGCAGG + Intergenic
1129160466 15:73744835-73744857 CTCGGCAAACACATTGAGACAGG - Intronic
1129852882 15:78804687-78804709 CAGAGAAAGCTCTTTGAGGCTGG - Intronic
1130250081 15:82294358-82294380 CAGAGAAAGCTCTTTGAGGCCGG + Intergenic
1132840365 16:1975890-1975912 CAGCTCAAACACTTTTAGGCAGG - Exonic
1133265000 16:4577861-4577883 CAGGAGAAACACTTTGAACCCGG + Intronic
1133420385 16:5641676-5641698 CAGGGCAAAGGCCTGGAGGCGGG + Intergenic
1133802307 16:9093044-9093066 CAGGGCAGACACCCTGACGCAGG - Intronic
1134041329 16:11070768-11070790 CAGAGCAAAGACTCTGAGGTGGG - Intronic
1135350666 16:21726545-21726567 AAGGGCACACACTGGGAGGCTGG - Exonic
1137568610 16:49550162-49550184 CAGTTTAAACAATTTGAGGCTGG - Intronic
1137624584 16:49899820-49899842 CAGGGCCACCACTTGGAGACTGG - Intergenic
1141344137 16:83229859-83229881 CAGACCAAACACTCTGAAGCTGG + Intronic
1141368922 16:83469444-83469466 CAGGAAAAACATATTGAGGCTGG + Intronic
1143943481 17:10568196-10568218 AAGGCCAAACACTGGGAGGCAGG + Intergenic
1145241921 17:21245178-21245200 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1146823153 17:36000726-36000748 CAGAGCATACACTTTAGGGCTGG - Intronic
1148834942 17:50461093-50461115 CAGGGCAGACCCACTGAGGCTGG + Intronic
1149543363 17:57485164-57485186 CAGGCCAACCTGTTTGAGGCTGG - Intronic
1152322095 17:79613354-79613376 AAGGGCAAACTCTCTGGGGCTGG - Intergenic
1156595753 18:38545850-38545872 CAGGGGAATGACTTTGAGTCTGG - Intergenic
1156884413 18:42117867-42117889 AAGAAAAAACACTTTGAGGCCGG - Intergenic
1157635425 18:49148798-49148820 GAGTGCAAAGGCTTTGAGGCAGG - Intronic
1157690410 18:49677341-49677363 TAATCCAAACACTTTGAGGCAGG + Intergenic
1158852511 18:61509448-61509470 CAGTGCAAAGGCTTTGAGGTGGG + Intronic
1158951711 18:62501136-62501158 CAAGTCAAACATTTTGAGGATGG - Intergenic
1160627001 18:80217460-80217482 CCGGGCAAACACTCTCAGCCAGG + Intronic
1160875438 19:1294432-1294454 CAGGGCAAAGGCCTGGAGGCAGG + Intronic
1161640329 19:5418728-5418750 CAGGGCAAGGACCCTGAGGCTGG + Intergenic
1162819375 19:13213239-13213261 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1162853507 19:13450290-13450312 CAGTGCAAAGGCTCTGAGGCTGG - Intronic
1163581037 19:18138892-18138914 CAGGGCAAAGGCTCTGAGGTGGG - Intronic
1164527853 19:29024934-29024956 AAGGGCCAACACCTTGGGGCTGG + Intergenic
1164583872 19:29453243-29453265 AAGGGCACAGAATTTGAGGCTGG + Intergenic
1165356119 19:35305182-35305204 AAGGGCAAGCACTTTGACACAGG - Intronic
1166109999 19:40616077-40616099 CAGTGCAAAGGCTCTGAGGCAGG + Intronic
1167287975 19:48609615-48609637 CTGGGCAAACAGTTTGGGGGTGG - Intronic
925726359 2:6876099-6876121 CAGGGTAAATACTTCCAGGCAGG + Intronic
926434548 2:12824697-12824719 CAGGAGAGACACTTTGAGGAGGG - Intergenic
928331335 2:30360156-30360178 CAGAGCACACGCTTGGAGGCAGG + Intergenic
929599691 2:43197356-43197378 CAGCACACACACTTTGAGCCAGG + Intergenic
930610460 2:53537265-53537287 CAGGGCAAGCTCATTGAGGAAGG + Intronic
931228969 2:60358142-60358164 CATGGCAAGCACGTTGGGGCTGG - Intergenic
931746354 2:65294854-65294876 AAGGGCAAACATTCTGAGGCAGG + Intergenic
933068749 2:77832611-77832633 CAGGACAATCACTTTGTTGCAGG - Intergenic
933314133 2:80695779-80695801 CAGATCCAATACTTTGAGGCTGG - Intergenic
935113737 2:100115318-100115340 CAGGCAGATCACTTTGAGGCAGG + Intronic
936909550 2:117576101-117576123 CAAAGCAAACACTTGGTGGCAGG + Intergenic
939084055 2:137696082-137696104 CAAGGCAGACACTTTGGGGGTGG - Intergenic
939279392 2:140042705-140042727 CAGCGCAAATACCTTGAGGCAGG - Intergenic
941011733 2:160307950-160307972 AAGGGCAATCACTTAGAGGATGG - Intronic
941103258 2:161322011-161322033 GAGGGCTAAGACTTTGAGCCAGG - Intronic
942649191 2:178149268-178149290 CAGTGCAAACACCCTGGGGCAGG + Intergenic
943745642 2:191460204-191460226 CAGGACTAACACTCTGAGGTAGG - Intergenic
945660891 2:212683960-212683982 CAAGGCAAACACCCTGAGGCAGG + Intergenic
946969893 2:225079923-225079945 CAGGGCAAACAGTTTGTGCAAGG - Intergenic
947330791 2:229027417-229027439 CAGAGCACAGTCTTTGAGGCAGG + Intronic
948763862 2:240209589-240209611 CAGTGCAGACACCCTGAGGCAGG - Intergenic
949053453 2:241910525-241910547 CAAGGGAGACACCTTGAGGCGGG - Intergenic
1168996363 20:2136100-2136122 CAGGGGACACATTCTGAGGCCGG + Intronic
1170048312 20:12111548-12111570 GAGTGCAAAGACTATGAGGCAGG + Intergenic
1170813186 20:19691328-19691350 GAGGGCAAAGTCCTTGAGGCAGG + Intronic
1170943203 20:20866315-20866337 CTGGGAAAACACTTGGAGGGAGG - Intergenic
1173041173 20:39464372-39464394 AAGAGCAAAGACCTTGAGGCAGG + Intergenic
1173314093 20:41927963-41927985 CAGTGCAAACATGTGGAGGCAGG - Intergenic
1173693281 20:44983067-44983089 CAGTGCAAAGACCTTGAGGCTGG + Intronic
1174121482 20:48268924-48268946 CAGGGCAAAGGCCCTGAGGCAGG - Intergenic
1174122236 20:48274710-48274732 CAGGGAAAAGACCTTGAAGCAGG - Intergenic
1175227378 20:57452496-57452518 CAGTGCAAAGGCCTTGAGGCAGG + Intergenic
1177417637 21:20815182-20815204 CAGGGGAAGCACATTGAGTCTGG - Intergenic
1178749219 21:35284498-35284520 CAGGGCAAAGACCCTGAGGTGGG - Intronic
1181796120 22:25312326-25312348 CAGGGCAAAGACCCTGAGCCTGG + Intergenic
1181836665 22:25615936-25615958 CAGGGCAAAGACCCTAAGGCTGG + Intronic
1182338793 22:29603226-29603248 CCGGGAAACCACTTAGAGGCTGG - Intergenic
1183366033 22:37407425-37407447 CAGTGAAAGCACTGTGAGGCTGG - Intronic
1184059488 22:42073638-42073660 AAGGGCAAAGGCTCTGAGGCGGG + Intergenic
1184582408 22:45426484-45426506 AAGGGCAAAGGCCTTGAGGCAGG + Intronic
949128439 3:473159-473181 AAGTTCAAACACTTTGAGGCAGG + Intergenic
950475441 3:13211722-13211744 CAGGGCAAAGGCCTGGAGGCTGG - Intergenic
950936623 3:16845766-16845788 CAGGGTAAGCAATTTGGGGCCGG + Intronic
951034295 3:17916161-17916183 CAGGCCAAACCCTTTGGGACAGG - Intronic
951414541 3:22407996-22408018 CAGGGAGAAGACTTTGAGGTGGG + Intergenic
951467081 3:23013288-23013310 CAGTGCAAAGACTCCGAGGCTGG - Intergenic
952150020 3:30579009-30579031 GAGAGCAAGCACTTTGAGGGAGG - Intergenic
953941571 3:47103580-47103602 CAGTGGAAAAACTTTGAAGCTGG - Intronic
954818575 3:53304407-53304429 CAGAGCAAACATTTTGAGGTTGG - Intronic
961426421 3:126851933-126851955 CAGGGCAAGCAACCTGAGGCTGG - Intronic
967881224 3:194303106-194303128 AAGTGCAAACATTGTGAGGCAGG + Intergenic
968970452 4:3791015-3791037 CAGGGCATGCCCTTTGAGGGTGG - Intergenic
969570688 4:8006499-8006521 CAGGGCAAATGCCTTGATGCCGG + Intronic
970060701 4:12030200-12030222 CAGAACAAAGACTTTGAGGCAGG - Intergenic
970605368 4:17676079-17676101 CATGTCAAAAACTTTGAGACAGG - Intronic
970946279 4:21696508-21696530 CAGGACACACACTTTGATTCTGG - Intronic
971643495 4:29166080-29166102 CAGGGCAAACAATTTGACAGAGG - Intergenic
976106617 4:81625796-81625818 AAGGGCAAAGGCTCTGAGGCAGG - Intronic
976768205 4:88620768-88620790 CAGGGTAAACACTCTGAGGAGGG - Intronic
979890122 4:126081896-126081918 AGGGGCAAACACTCTGAGGCAGG + Intergenic
985487548 5:159907-159929 CAGGGCACAAACCTGGAGGCCGG - Intronic
987858288 5:23450074-23450096 TAGGGCAAAGACTTTGAAGTTGG + Intergenic
990005264 5:50938223-50938245 CAAGGCAAACTCTGTGAGACAGG + Intergenic
990891193 5:60652045-60652067 GAGAGCAAGCACTTTGAGGGAGG + Intronic
992186177 5:74246877-74246899 AAGGGCACAGACTTTGAGGCTGG - Intergenic
995380399 5:111525293-111525315 CGAGGCAAACACTTTCAGGTAGG + Intergenic
995466261 5:112452187-112452209 CAGGGCATGCACTGTGAGGCTGG - Intergenic
995768491 5:115644845-115644867 AAAGGCAAAGACTTTGATGCTGG + Intergenic
997214571 5:132100139-132100161 CAGCGCAAAGGCTCTGAGGCTGG - Intergenic
997376794 5:133403282-133403304 CAGGGCACACGCTCTGAAGCAGG - Intronic
997376815 5:133403417-133403439 CAGGGCAGGCACTTTGGGGTAGG - Intronic
998314379 5:141168208-141168230 CAGGGAAAACTCTTAGAAGCTGG + Intergenic
999537151 5:152529676-152529698 CAAGGCAAAGGCTTGGAGGCAGG + Intergenic
999893192 5:156000917-156000939 CAGGGACCACACTTTGAGGATGG + Intronic
1001637639 5:173223483-173223505 CAGTGCAAAGACTCTGAGGCAGG + Intergenic
1002328302 5:178424415-178424437 CAGGGAAAACCCTTTGATCCAGG + Intronic
1004091133 6:12503025-12503047 CTGGGCAAAGACTTGGAGGAAGG - Intergenic
1004329750 6:14710601-14710623 AAGGGCCAAGACTGTGAGGCAGG + Intergenic
1004761488 6:18671539-18671561 AAGGGCAAGGACTCTGAGGCAGG - Intergenic
1005665840 6:28053417-28053439 CAGGGAAACCACTGTGAGGTGGG + Intergenic
1006407032 6:33851455-33851477 CAGGACAAAGACCTTGTGGCCGG - Intergenic
1010067133 6:71695911-71695933 CATGGCAACCATTTTGAGGCTGG - Intergenic
1010534833 6:77013669-77013691 CTGAGCATACACTCTGAGGCTGG - Intergenic
1012119013 6:95340097-95340119 CTGGGCAAAGACTATGATGCAGG - Intergenic
1016769165 6:147829248-147829270 CACAGCAAACAGCTTGAGGCAGG - Intergenic
1016813134 6:148280246-148280268 CAGGGCAACCACCCAGAGGCAGG - Intronic
1017745591 6:157444318-157444340 CACGGAATACACATTGAGGCAGG + Intronic
1019006025 6:168796796-168796818 CATGGTAATAACTTTGAGGCAGG + Intergenic
1020700294 7:11473712-11473734 CAGGGCAAACACTTTGCTGGAGG - Intronic
1021543395 7:21785998-21786020 CAGGGCAAACACTTTGAGGCAGG - Intronic
1026467604 7:70668070-70668092 CAGGACAACCACTTGGACGCAGG - Intronic
1026491795 7:70869940-70869962 CAGGGGAATCACTTGGAGCCGGG - Intergenic
1026683730 7:72490503-72490525 CATATCAAACACTTTGAGGTAGG - Intergenic
1029977092 7:104845034-104845056 CATGGGAAATACTTAGAGGCCGG - Intronic
1033419995 7:141197165-141197187 CAGGGAAAGCACTTTGTGCCTGG - Intronic
1034010212 7:147521529-147521551 CATGGGAAACACCTTGGGGCAGG - Intronic
1034893049 7:154857472-154857494 CATGGCAAACACCTGGAGGCTGG - Intronic
1035919212 8:3658688-3658710 CAGGGGAAACACTTGAACGCAGG + Intronic
1036023938 8:4881886-4881908 CAGGGGAAAAACATTGATGCTGG + Intronic
1039839033 8:41280468-41280490 CAGGGCATTCAGCTTGAGGCCGG - Intronic
1041780624 8:61575008-61575030 CAAGTCAAAGGCTTTGAGGCAGG - Intronic
1044798150 8:95924930-95924952 CAGAGCAAACACTGTTAGCCAGG - Intergenic
1044934487 8:97279587-97279609 CAGTGCAAAGGCTCTGAGGCAGG - Intergenic
1045358060 8:101406695-101406717 AAGGGCAAAGGCTGTGAGGCAGG - Intergenic
1046697792 8:117361200-117361222 CAGGGTAAACACTTTGGAGCAGG - Intergenic
1047090148 8:121565494-121565516 CAGGAGAATCACTTGGAGGCAGG + Intergenic
1047582108 8:126227243-126227265 CAGGGCCAGCACTTTGAGAATGG + Intergenic
1047668471 8:127118627-127118649 CAGGGCAAAGCCTCTGAAGCAGG - Intergenic
1047855120 8:128901079-128901101 TAGAGCAAACCCTTTGAGGTTGG - Intergenic
1048034670 8:130666161-130666183 CAGGACAGACACCTGGAGGCGGG - Intergenic
1048364224 8:133724287-133724309 TAGTGCAAAAACTCTGAGGCAGG - Intergenic
1049318919 8:141985545-141985567 CAGGGGATACACTATGATGCAGG - Intergenic
1051554073 9:18363261-18363283 CATGGCCAACAATTTGTGGCAGG - Intergenic
1052221797 9:26032944-26032966 CAGGGCAAAGAAATAGAGGCAGG - Intergenic
1056956833 9:91089351-91089373 CAGGGCATCCACTTAGAGGAAGG - Intergenic
1061165093 9:128917636-128917658 AAGAGCAGACACTTAGAGGCTGG + Exonic
1186672223 X:11779659-11779681 CAGGGCCAAGACCCTGAGGCAGG + Intergenic
1189052927 X:37665336-37665358 AAGGGCAAAGACATGGAGGCAGG - Intronic
1189227278 X:39423310-39423332 CAGTGCAAAGGCCTTGAGGCAGG - Intergenic
1189551343 X:42096723-42096745 GAGAGCAAACACTTTGAGGGAGG - Intergenic
1189558329 X:42167649-42167671 CAGTGCAAACACCTCAAGGCTGG + Intergenic
1189674081 X:43443345-43443367 CAGTGCAAACACTTTCACACTGG - Intergenic
1189677381 X:43475784-43475806 CAGTGCAAACACTTTCACACTGG - Intergenic
1190220761 X:48511107-48511129 CAGGGCAAAGGCCTTCAGGCTGG - Intronic
1190482697 X:50893269-50893291 GAGAGCAAGCACTTTGAGGGAGG - Intergenic
1192157022 X:68754250-68754272 CAGTGCAAAGACCCTGAGGCAGG - Intergenic
1192239930 X:69320871-69320893 CAGGGGAAAGACCTGGAGGCTGG - Intergenic
1195951299 X:110276726-110276748 CAAGGGCAACACTGTGAGGCTGG - Intronic
1198260224 X:134959401-134959423 CAGGGCATACAGTGTAAGGCTGG - Intergenic
1199773243 X:150988411-150988433 CAGGGCGTGCACTGTGAGGCTGG + Exonic
1199856825 X:151766058-151766080 CAGGGGACAGACTTTGAGGAGGG - Intergenic
1200882996 Y:8240091-8240113 CAAGGCAAATAATTTGAGACTGG + Intergenic