ID: 1021548400

View in Genome Browser
Species Human (GRCh38)
Location 7:21842387-21842409
Sequence CTGCTGTACTTTAGGAAATT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 175
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 159}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021548400 Original CRISPR CTGCTGTACTTTAGGAAATT TGG Intronic
903493450 1:23747018-23747040 CTGCTTTACTTTGGGTTATTAGG - Intronic
904546101 1:31274050-31274072 CTGCTGGATTGTAGGAGATTAGG + Intronic
906270486 1:44473979-44474001 CGACTGTACTTAATGAAATTAGG - Intronic
907765018 1:57400854-57400876 GTGCTGTCCTCTAGAAAATTAGG - Intronic
908282648 1:62558072-62558094 CTTCCACACTTTAGGAAATTGGG - Intronic
909556093 1:76956057-76956079 CTGCCTTATTGTAGGAAATTGGG + Intronic
915168016 1:153959327-153959349 CTGCTGTACCCTAGGAATATGGG - Exonic
915623900 1:157102865-157102887 CTGCTTCACCTTAGGAAAATGGG + Intergenic
916274328 1:162977562-162977584 CTTATGTACATTAGGAAACTTGG - Intergenic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
919169061 1:193930939-193930961 CTGGTGTACTTTTGGTACTTTGG + Intergenic
922126442 1:222730104-222730126 CATCTGTTCTTTAGGAAACTTGG + Exonic
1063350421 10:5349162-5349184 CTGCTGTAAGTTAGGAAAACAGG - Intergenic
1064062604 10:12151262-12151284 CTTCTTCACTTTATGAAATTGGG + Intronic
1064293262 10:14054424-14054446 CAGCTGTGTTTTGGGAAATTAGG - Intronic
1064307491 10:14181013-14181035 TTGCTGTTCTTTAGAAAATGGGG - Intronic
1064611638 10:17109428-17109450 CTGCTCTGATTTAGGAAATAAGG - Intronic
1074633196 10:115282505-115282527 TTGCTGTAGTTTATAAAATTCGG - Intronic
1080233457 11:30043659-30043681 CTGCTGTGCTTTAGAAAGCTGGG - Intergenic
1080277526 11:30519702-30519724 TAGCTGTAATTTAGGAATTTAGG - Intronic
1081824941 11:46040554-46040576 CTGCAGTACATTAGAAAATTAGG + Intronic
1083037728 11:59655897-59655919 CTAATGAACTTTAGGAAAGTAGG + Intronic
1083340186 11:61954308-61954330 CTGCTGTACGCTATGAACTTTGG - Intronic
1090624162 11:128591276-128591298 CTTCTGCACTTTAGGGAGTTGGG - Intergenic
1091197211 11:133741784-133741806 TTGCTACACTTTAGGAACTTGGG - Intergenic
1094683664 12:32688856-32688878 CTGCAGTATTTTAGAAAGTTTGG + Intronic
1095815153 12:46413485-46413507 GTGCTATTCTTTAGCAAATTGGG - Intergenic
1097966586 12:65588032-65588054 GTGCTGTACTTAAGGAAATCTGG - Intergenic
1098459904 12:70721169-70721191 CTGGAGAACTTTAGGATATTTGG - Intronic
1098589360 12:72191521-72191543 CTGCAGAATTTTAGGATATTAGG - Intronic
1100075381 12:90774718-90774740 TTGCTGCAATATAGGAAATTAGG + Intergenic
1100298144 12:93281734-93281756 CTGTTGTAAATTAAGAAATTGGG + Intergenic
1101949790 12:109165706-109165728 CTACTGTAATTTAGCAAACTGGG - Intronic
1103068287 12:117918379-117918401 TTGCTGTAGTTTAGGGAAGTTGG - Intronic
1105463235 13:20611260-20611282 CAGATGTACTTTATCAAATTGGG - Intronic
1105473680 13:20713432-20713454 CTGCTGTATTTTAAGAAGCTGGG - Intronic
1107022194 13:35763849-35763871 CTGCTGTGCGGTGGGAAATTTGG + Intergenic
1107373750 13:39780174-39780196 CGGCTGTACTTGAGAAAAGTAGG - Intronic
1108700687 13:52941504-52941526 CTGCTGTTCTCTAGGAACCTGGG + Intergenic
1108786966 13:53915749-53915771 TTGCTGTAGTCTTGGAAATTAGG + Intergenic
1109429689 13:62215382-62215404 TTGTTCTACTTTAGGAAATCAGG - Intergenic
1109941607 13:69374732-69374754 ATTCTGTACTTAGGGAAATTGGG + Intergenic
1110736744 13:78946128-78946150 CTGCTATACTTTAGGACTCTTGG - Intergenic
1114847374 14:26339524-26339546 CTGCTTTGCTTTCGAAAATTTGG + Intergenic
1116580645 14:46637119-46637141 CTGCTGCACTTGAGGAACCTAGG + Intergenic
1117603973 14:57406401-57406423 TTGCTTTACTTTGGGAAATGAGG + Intronic
1118013487 14:61634480-61634502 CTGCTTTAATTTAGAAAATAAGG + Intronic
1119955272 14:78791470-78791492 GTACTGTACTTTAGGAACATAGG - Intronic
1125244809 15:37622794-37622816 CTGCTATTCTTTAGGTAAATGGG + Intergenic
1126226775 15:46280045-46280067 CTGCTCTACTCTAAGAAACTTGG - Intergenic
1127348219 15:58123059-58123081 CTACTGAAGTTTGGGAAATTTGG - Intronic
1128431895 15:67604350-67604372 TTGCAGCACTTTAGGAAATGAGG - Intronic
1128515059 15:68336942-68336964 AGGCTGTACTTTGGGAAATGAGG + Intronic
1129464149 15:75714493-75714515 CTGCTGTTCTGTAGGGATTTTGG + Intergenic
1134248366 16:12556795-12556817 CTTCTGTACTTTAGTAAAGGGGG - Intronic
1134314528 16:13106313-13106335 CTGATGTACAGTAGCAAATTTGG + Intronic
1134624001 16:15711048-15711070 CTGCTGTACTTTGGGAGCCTAGG + Intronic
1137737545 16:50736160-50736182 CCGCTGGACTTTTGAAAATTAGG - Intergenic
1141578838 16:84983393-84983415 CTGCTGAACTTTCTAAAATTTGG - Intronic
1141873406 16:86805180-86805202 CTTTTGTATTTTAGGAAATTTGG + Intergenic
1143952181 17:10641969-10641991 CTGGTGTCCTTTAGGAAAATTGG + Intronic
1145214218 17:21040618-21040640 ATTCTTAACTTTAGGAAATTAGG + Intronic
1148515907 17:48217012-48217034 GAGATGTACTTTAGGAAATCTGG - Intronic
1150952516 17:69819694-69819716 TTGCTGAAGTTTAGGAAATGTGG - Intergenic
1151209586 17:72534363-72534385 AGGCTGTGCTTCAGGAAATTAGG - Intergenic
1151371161 17:73647002-73647024 CTGCTGGACTTCTGGGAATTGGG - Intergenic
1155043557 18:22084957-22084979 CAGGTTTAATTTAGGAAATTTGG - Intergenic
1156565648 18:38186509-38186531 CTGCTGAACTTAAAGAAATATGG - Intergenic
1158110944 18:53940984-53941006 CTGCTGGATTTCAGGAAATCGGG + Intergenic
1159254135 18:65923596-65923618 TTGCTGTACTTAAGAATATTGGG + Intergenic
1159913016 18:74164422-74164444 CTGCTGTCAGCTAGGAAATTAGG + Intergenic
925045806 2:772393-772415 TTGCTGTCCTTTGGGAAATGGGG - Intergenic
925065397 2:925793-925815 CTGCTGTTCTCTCGGAAATCAGG + Intergenic
926618834 2:15028302-15028324 CTGCTTTACTTCAACAAATTTGG + Intergenic
930730144 2:54721401-54721423 CTGCTATACTTTATTAAATGAGG + Intergenic
936681157 2:114772948-114772970 CTATTGTAGTTTATGAAATTTGG + Intronic
936815726 2:116457792-116457814 CTTCTATACTTTAAAAAATTAGG - Intergenic
937736817 2:125301302-125301324 CTGTTTTACTTTAGGACATGGGG - Intergenic
940119452 2:150247437-150247459 CTGATGTACTTTATGACCTTTGG - Intergenic
942108996 2:172661401-172661423 CTGCTGTTCTTGAGGTTATTTGG + Intergenic
945665260 2:212733630-212733652 CTGCTGTGCTTGCAGAAATTTGG + Intergenic
945806316 2:214494042-214494064 CTTTTGAACTTTAGAAAATTAGG - Intronic
1170990218 20:21294503-21294525 CTGCTGTAGTTAAGGAACTATGG - Intergenic
1173119479 20:40275815-40275837 CTGCTGTATTTTTGGAAACGGGG - Intergenic
1173212783 20:41049774-41049796 CTTCTGTCCTTAAGGAAGTTGGG - Intronic
1173702759 20:45087586-45087608 CTGCTGCACTTTGTGAAGTTAGG + Intergenic
1173933556 20:46841756-46841778 CTTCTGTCCTCTGGGAAATTTGG - Intergenic
1175450359 20:59060590-59060612 CTGCTATAACTTAGGAAATTGGG + Intergenic
950113586 3:10435953-10435975 CTGCTTTCCTTTAGGGGATTTGG + Intronic
951378948 3:21958678-21958700 CTGCAGTAATTTAGAAAAATAGG - Intronic
952277355 3:31890320-31890342 CTGCTGTGATTTAGGAAAGCTGG - Intronic
953918602 3:46936702-46936724 CTGCTTTAATTTAGGGACTTAGG - Intronic
957425321 3:80031161-80031183 CTGCTGAACTGTAGGACACTTGG + Intergenic
958513199 3:95075805-95075827 ATGCTGGACATTAGGGAATTAGG - Intergenic
958560310 3:95740873-95740895 CTTCTGTATTTTACCAAATTTGG - Intergenic
960601696 3:119465033-119465055 CTGTGGTACATTAGGACATTAGG - Intronic
962408527 3:135121099-135121121 CTGCTGAACTTTTGGATACTAGG - Intronic
963166995 3:142214390-142214412 TTGCTATATTTTAAGAAATTTGG - Intronic
964597470 3:158451821-158451843 CTACTGTATTTTAGAAAATGAGG + Intronic
964772040 3:160234405-160234427 CAGCTGTACTTCTGGAATTTAGG + Intronic
965073008 3:163940163-163940185 CTCCTGTAATTTAAGAACTTTGG - Intergenic
966590816 3:181680860-181680882 CTGCTGTACCTTACAAAATTAGG + Intergenic
967575400 3:191084647-191084669 TTGATGTACTTTATGAAATACGG + Intergenic
968584998 4:1412204-1412226 CTGCCTTACTTGAGGAAATCAGG - Intergenic
968839357 4:2990665-2990687 CTGCTGTATTTTAAGAATTTAGG + Intronic
970313152 4:14803936-14803958 CTGATGCACTTTAGAATATTTGG + Intergenic
971537695 4:27774295-27774317 CTGCTTTATTTTAATAAATTTGG + Intergenic
971752816 4:30673117-30673139 TTGCTATTCTTTAGGAAAATTGG - Intergenic
973841350 4:54864343-54864365 CTGCTGTTGTTTAGGAATTCAGG - Intergenic
976500987 4:85788805-85788827 TAGCTGTACTTTAAGAACTTGGG - Intronic
977202925 4:94138198-94138220 CTACTGTACTATAGGGAATAAGG + Intergenic
979273500 4:118790444-118790466 ATGCTGTATTTTAGGAACTGAGG - Intronic
979821703 4:125181963-125181985 CAGTTGTATTTTAGGAAATTGGG + Intergenic
980072986 4:128263493-128263515 CAGCTGGGCTTTAGTAAATTAGG + Intergenic
980490951 4:133527837-133527859 TTGCAGTATTTTAGGGAATTTGG + Intergenic
980809028 4:137851921-137851943 CTGTTTTACTTCAGGATATTGGG + Intergenic
981207093 4:142055414-142055436 CTGCTTTACTTTATGAATTGGGG - Intronic
981214191 4:142144436-142144458 CTGCTGTCCTCTAGAAAATGAGG - Intronic
983095537 4:163557192-163557214 ATGCTGTAAATGAGGAAATTTGG - Intronic
983912038 4:173250719-173250741 CTGCTGCACGTTAGGAGTTTGGG - Intronic
984171157 4:176360918-176360940 CTGCTGTACTTTAGGAGAAAGGG - Intergenic
986317614 5:6601077-6601099 CTGCTTTACATTAGGAAAAATGG - Intronic
987429824 5:17819143-17819165 ATGCTATATTTTAAGAAATTAGG + Intergenic
990387014 5:55274946-55274968 CTGCTGTACTTTTGGTAAAATGG + Exonic
992226976 5:74628347-74628369 TTGCTGTATTTTAGAAAATAGGG - Exonic
994735894 5:103555510-103555532 CTGCTGTAGATTTGGAAATCTGG - Intronic
995349915 5:111163325-111163347 GTGCTGTGCTTTAGGACCTTTGG + Intergenic
997872990 5:137521662-137521684 CAGCTAGACTTTAGGAAATTAGG + Intronic
998024032 5:138798060-138798082 CCTCTGTCCTTTAGGAAACTTGG + Intronic
999303434 5:150505036-150505058 CTGCTATACTTTAATAAAGTTGG + Intronic
999356959 5:150944323-150944345 CTGCTTTGGTTTAGGAAATAAGG - Intergenic
1004835010 6:19520993-19521015 CTGCTGGGCTTCAGGAAGTTGGG - Intergenic
1008660431 6:53662207-53662229 CTGCTGTCATTTAGGAAAAATGG - Intronic
1008876571 6:56336115-56336137 CTGATGTACTTTGAGAAATCTGG - Intronic
1009991059 6:70843233-70843255 CTGCTGTACTGTATAGAATTGGG + Intronic
1010490029 6:76464901-76464923 CTGCTGTACTATATGAAGTGAGG - Intergenic
1010771768 6:79840112-79840134 CTGCTGTGCTGCAGGAAATCAGG + Intergenic
1014966837 6:127764570-127764592 CTGCATTATTTTAGGAAATAAGG - Intronic
1016487634 6:144559982-144560004 CTGCTATACTTTGTGAGATTTGG + Intronic
1017517987 6:155174788-155174810 CTGCTGCACTTTTGGAGATCAGG - Intronic
1020476540 7:8601680-8601702 TTCCTGTATTTTAGGGAATTGGG - Intronic
1020856476 7:13432168-13432190 TTGCTGTTCTCTAAGAAATTTGG + Intergenic
1021528570 7:21617605-21617627 CCACTTTTCTTTAGGAAATTTGG + Exonic
1021548400 7:21842387-21842409 CTGCTGTACTTTAGGAAATTTGG + Intronic
1024816087 7:53273584-53273606 CTGCTTTGCTTTGGGATATTTGG + Intergenic
1024929035 7:54650465-54650487 CAGCTGTGCTTTAGGTATTTTGG + Intergenic
1025012870 7:55412563-55412585 CTGGGGTACTATAGGAAAATTGG + Intronic
1026073571 7:67144789-67144811 CTGCTGTGCTGTAGGAAGTTTGG - Intronic
1026635653 7:72079655-72079677 CTGTTGTTTTTTAGGAACTTGGG + Intronic
1026703314 7:72667391-72667413 CTGCTGTGCTGTAGGAAGTTTGG + Intronic
1026909679 7:74084506-74084528 CTTCTGTACATTTGGAAACTGGG + Intronic
1028512990 7:91645315-91645337 CAACTGTACTTTTTGAAATTTGG + Intergenic
1030229497 7:107192175-107192197 CTGCTTTCCTTTTGGAAGTTTGG - Intronic
1033393097 7:140947689-140947711 CTGCTATAATTTAAGAAATCTGG + Intergenic
1033849983 7:145483116-145483138 CTACTTGACTTTAGGAAGTTTGG - Intergenic
1035290300 7:157833676-157833698 CTCCTGGGTTTTAGGAAATTGGG + Intronic
1040609641 8:48970559-48970581 CTGCTGTATATTGGGAAAGTGGG - Intergenic
1040832750 8:51695989-51696011 GTGCAGTATTTTAGGAAATTGGG - Intronic
1046005309 8:108474085-108474107 ATACTGTACTTTATAAAATTGGG + Intronic
1048283888 8:133126524-133126546 CTGCTGAGCTTTAGGAAGTTAGG + Intronic
1048525614 8:135199712-135199734 CTGCTCTTCTTTAGGAAATTAGG - Intergenic
1050297732 9:4222970-4222992 CTGTTGTTCCTTAGGGAATTAGG + Intronic
1051151409 9:14083515-14083537 TTTCTGGACTTTAAGAAATTGGG - Intronic
1051745941 9:20294456-20294478 CTGCTGCATTTTAGGAAACGTGG + Intergenic
1060972145 9:127744469-127744491 CTGCTGTACTTGGGGAATCTGGG + Intronic
1185642181 X:1594410-1594432 GTGCTGTGGTTTTGGAAATTTGG + Intronic
1190033876 X:47001556-47001578 CAGCTGTGGTTGAGGAAATTAGG - Intronic
1190181539 X:48196543-48196565 CTGCAGTAACTTAAGAAATTTGG - Intronic
1190847425 X:54207322-54207344 CTTCTGTACTTAAAAAAATTTGG - Intronic
1193929782 X:87539253-87539275 CTGCTGCACTTTATGAGATGTGG + Intronic
1195523368 X:105856656-105856678 CTGCTGTACCTAAGAAAATCAGG - Intronic
1195724810 X:107903630-107903652 CTGCTGTTCTTTTGGAAAGAGGG - Intronic
1197268510 X:124401368-124401390 CTTCTGTACTGTGGGAAATGGGG - Intronic
1200371800 X:155734290-155734312 CTGTTGTATTTTAGGGAATAGGG + Intergenic
1201344673 Y:12969228-12969250 CTGCTGCACTTTATGTAAATAGG - Intergenic