ID: 1021550951

View in Genome Browser
Species Human (GRCh38)
Location 7:21870269-21870291
Sequence AAGGCACCGAGCCTGGATAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 117}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021550951_1021550955 4 Left 1021550951 7:21870269-21870291 CCAGTATCCAGGCTCGGTGCCTT 0: 1
1: 0
2: 0
3: 6
4: 117
Right 1021550955 7:21870296-21870318 ATTTCTGCTTGAAATGCAACTGG 0: 1
1: 0
2: 0
3: 17
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021550951 Original CRISPR AAGGCACCGAGCCTGGATAC TGG (reversed) Intronic
902595560 1:17507399-17507421 ATGGCACCCAGCCAGGACACTGG - Intergenic
903020092 1:20387507-20387529 AAGGCACCAAGCCTGGACATGGG - Intergenic
904198853 1:28806096-28806118 AAGGCAGCAAGCCTGGGTGCAGG + Intergenic
907947771 1:59151401-59151423 AAGAGGCCGAGCCTGGATCCTGG + Intergenic
909024494 1:70467461-70467483 AAGGCACCGAGAGTGGATGGAGG + Intergenic
910843685 1:91585589-91585611 AAGGCACCGTGCCTGCCTTCAGG - Intergenic
912234527 1:107835229-107835251 AAGGCACTGAGGCTGGGTAATGG - Intronic
912591509 1:110825103-110825125 AAGGCATTGAGAGTGGATACAGG - Intergenic
913571821 1:120128075-120128097 AATGCCCCAAGCCTGGATGCTGG + Intergenic
914292740 1:146289697-146289719 AATGCCCCAAGCCTGGATGCTGG + Intergenic
914553784 1:148740480-148740502 AATGCCCCAAGCCTGGATGCTGG + Intergenic
916031936 1:160884613-160884635 AAAGCACAGAGCCTGGACCCAGG + Intronic
919841939 1:201615596-201615618 AAGGCACCTAGCTTGGTGACTGG - Intergenic
923052423 1:230398132-230398154 AAGGCAGGGAGGCTGGATTCTGG - Intronic
1062818457 10:516918-516940 ATGGCCCCGGGCCTGGAAACTGG - Intronic
1062978629 10:1703390-1703412 AAGGCTTGGAGCCTGGATGCTGG + Intronic
1065322283 10:24520905-24520927 GAGCCACCGTGCCTGGTTACAGG - Intronic
1067221635 10:44348152-44348174 AAGGCACTGAACCTGGACATAGG + Intergenic
1070961407 10:80502563-80502585 AAGGCACCAAGCCTGGGGTCTGG + Intronic
1071454595 10:85836348-85836370 AAGGCACCGAGAGTGGATGGAGG + Intronic
1073251233 10:102121254-102121276 AAGGCACCAAGGCTGGAGAAAGG - Intergenic
1074824816 10:117207010-117207032 AAGGCACCCATCCTGGATTTGGG - Intronic
1077793059 11:5461875-5461897 AAGGCATCCAGAGTGGATACAGG - Intronic
1083351445 11:62032099-62032121 AAGGCACCGAACCAGGAGATAGG + Intergenic
1084617419 11:70245813-70245835 AAATCACCGAGTCTGGATCCTGG - Intergenic
1085815089 11:79728457-79728479 AAGGCACCGAGAGTGGATGGAGG - Intergenic
1085856574 11:80182112-80182134 AAGGCACCGAGAGTGGATGAAGG - Intergenic
1094429190 12:30348051-30348073 AAGGCACAAAGACTGGATCCTGG - Intergenic
1098025153 12:66193757-66193779 ATAGTACCGACCCTGGATACAGG - Intronic
1111908489 13:94283502-94283524 AAGGCAAGGAGCCAGGATGCAGG - Intronic
1114620918 14:24095478-24095500 AAAGCTCAGAGCATGGATACGGG - Intronic
1118478440 14:66140911-66140933 AAGGCACTGAGCGTGGACAGAGG + Intergenic
1119406067 14:74400502-74400524 AAGGCAGCGAGACGGGAAACAGG + Intergenic
1119407922 14:74410360-74410382 AAGGCCCCGTGGTTGGATACAGG + Intronic
1122282156 14:100629777-100629799 AAGGCACAGAGCCTGAATCAGGG - Intergenic
1127260300 15:57322510-57322532 AAGGCAGTGACCGTGGATACGGG - Intergenic
1128007143 15:64253853-64253875 GAGCCACCGCGCCTGGCTACTGG - Intronic
1132836952 16:1958944-1958966 AAGGCACCTACCCTGGGCACAGG - Intergenic
1132983580 16:2752085-2752107 GAGGCCCCGAGCCTGGCTGCAGG - Intergenic
1133108801 16:3533330-3533352 CAGGCACGGAGCCTGGAGGCGGG + Intronic
1134420504 16:14083469-14083491 AAGGCACAGTCCCTGGGTACTGG + Intronic
1135281854 16:21159278-21159300 AAGGCACAGAGACTGAATAATGG - Intronic
1137001926 16:35236516-35236538 AAGGCACAGAGCAGTGATACTGG + Intergenic
1137716921 16:50603763-50603785 AAGGTATCGTGCCTGGATTCTGG + Intronic
1139939962 16:70598128-70598150 AAGGCACCGCGCCTGGTTGAAGG + Intronic
1142702568 17:1672944-1672966 ATGGCACAGAGCATGGAAACTGG + Intronic
1142759037 17:2032662-2032684 AAGGCACCAAGCAGGGAGACTGG + Intronic
1143056826 17:4168994-4169016 AAGGCAGGGAGCCTGCAGACGGG - Intronic
1151202022 17:72475692-72475714 CAGGTACCCAGCCTGGATCCAGG + Intergenic
1151680294 17:75619509-75619531 CAGGCCCCCAGCCTGGATCCTGG + Intergenic
1152474960 17:80512083-80512105 AAGGCAGCAGGCCTGGATGCCGG + Intergenic
1153094179 18:1382624-1382646 AAGGCACTGAGAGTGGATAGAGG + Intergenic
1155254072 18:23979395-23979417 TAGGCATGGAGCTTGGATACTGG - Intergenic
1159217205 18:65408522-65408544 ATGGCACTGTGCCTGGATACAGG + Intergenic
1161692077 19:5741728-5741750 GAGGCACCGCGCCTGGACAGCGG - Intronic
1163121017 19:15217808-15217830 GAGCCACCGTGCCTGGACACTGG + Intergenic
1166710416 19:44933489-44933511 GAGCCACCGAGCCTGGCTTCAGG - Intergenic
926298037 2:11582440-11582462 CAGGCACAGAGCATGGAGACAGG - Intronic
926696997 2:15777504-15777526 CAGGCAGCGAGCCTAGATACAGG + Intergenic
927666424 2:25036056-25036078 AAGTCACCCAGCCTGGAGGCAGG + Intergenic
930151382 2:48063439-48063461 AAGACACCAAGCCTGGCTTCTGG + Intergenic
940861066 2:158771305-158771327 AAGGCACCGGGCCTGGTACCTGG + Intergenic
941709242 2:168694365-168694387 TAGGCACCCAGCCAGGATATCGG - Intronic
1168842791 20:920595-920617 AAGGCTCCAGGCCTGGACACAGG - Intergenic
1174201390 20:48808909-48808931 AAGGGGCAGAGCCTGGATTCAGG + Intronic
1174295897 20:49544839-49544861 AAGGCACACAGCTTGGATAAGGG + Intronic
1175381563 20:58567631-58567653 AAGGCCGGGAGCCTGGATACTGG + Intergenic
1175714847 20:61248357-61248379 CAGGCACAGAGCCTGGATGGGGG + Intergenic
1175906794 20:62384293-62384315 ACTGCACCCAGCCTGGATACAGG + Intergenic
1176336966 21:5608097-5608119 AAGCCACCGTGCCTGGCTAGGGG - Intergenic
1176390791 21:6212851-6212873 AAGCCACCGTGCCTGGCTAGGGG + Intergenic
1176470628 21:7103323-7103345 AAGCCACCGTGCCTGGCTAGGGG - Intergenic
1176494189 21:7485101-7485123 AAGCCACCGTGCCTGGCTAGGGG - Intergenic
1176506453 21:7653282-7653304 AAGCCACCGTGCCTGGCTAGGGG + Intergenic
1179465320 21:41567931-41567953 AAGGGAGCGAGCCTGGCTTCAGG + Intergenic
1182472350 22:30556221-30556243 CAGGCACCCAGCCTGGACTCAGG - Intronic
1183674768 22:39292983-39293005 GAGGCACCGGGCTAGGATACAGG + Intergenic
949538596 3:5014623-5014645 AAGGCACAGAGCCTGGCTTGTGG + Intergenic
950937064 3:16850030-16850052 AATGTAATGAGCCTGGATACAGG + Intronic
959041008 3:101423673-101423695 AAGGCACAGAGACTGGATGGAGG + Intronic
960987044 3:123287479-123287501 AATGCCCCGTGCCTGGAGACAGG - Intronic
970311292 4:14784988-14785010 AGGGCACAGAGCTTGGACACTGG - Intergenic
971708385 4:30078530-30078552 AAGGCACTGAGAGTGGATAGAGG - Intergenic
971803574 4:31325112-31325134 AAGCCACTGTGCTTGGATACAGG + Intergenic
975428654 4:74260317-74260339 AAGGCATTGAGAGTGGATACAGG - Intronic
980503221 4:133683460-133683482 AAGGCATTGAGAGTGGATACAGG + Intergenic
981364471 4:143886111-143886133 AAGGCACAGAGGCTTGTTACTGG + Intronic
981385587 4:144126583-144126605 AAGGCACAGAGGCTTGTTACTGG + Intronic
986446579 5:7826392-7826414 AAGGAATTGAGCCTGGATCCAGG - Intronic
993311326 5:86337331-86337353 AAGGCACCGAGAGTGGATGGAGG + Intergenic
998756080 5:145380334-145380356 AAGGCACCAAGAGTGGATAAAGG - Intergenic
1000052474 5:157575140-157575162 CAGGCACCGAGCCTGGTCCCAGG + Intronic
1001303871 5:170557279-170557301 TAGCCACCATGCCTGGATACTGG - Intronic
1003504571 6:6729174-6729196 GAGGCACTGCGCATGGATACTGG - Intergenic
1005829089 6:29656430-29656452 AAGGGACAGAGCCAGCATACAGG - Intergenic
1006138509 6:31912398-31912420 AAGGAAGGGAGCCTGGATACAGG - Intronic
1006734954 6:36266974-36266996 AAGCCACCCAGGATGGATACTGG - Intronic
1007239896 6:40417298-40417320 GAGGCACTGAGCATGGAGACAGG - Intronic
1007481538 6:42153603-42153625 AAGACACTGAGCCTGGAGAGGGG + Intergenic
1007584886 6:42983408-42983430 GAGCCACCGAGCCTGGCCACAGG + Intergenic
1008207945 6:48686340-48686362 AAGGCACAGAGAGTGGATGCAGG + Intergenic
1008418389 6:51269506-51269528 AATGCACTGAGGCTGAATACTGG - Intergenic
1010655185 6:78503383-78503405 AAGGCATTGAGAGTGGATACAGG - Intergenic
1014844354 6:126257819-126257841 ATGGCACTGAGCCTGGCCACAGG + Intergenic
1016453782 6:144210317-144210339 AAGGCACCAAGAATGGATGCAGG - Intergenic
1017908389 6:158772328-158772350 AAGGCACTGAGCCTGGTGAAGGG - Intronic
1019395041 7:813558-813580 AAGACAGCGAGCCTGCCTACGGG + Intergenic
1019916653 7:4137408-4137430 AAGGAGCTGAGGCTGGATACTGG - Intronic
1021550951 7:21870269-21870291 AAGGCACCGAGCCTGGATACTGG - Intronic
1029973196 7:104809454-104809476 GAGGCACTCAACCTGGATACAGG + Intronic
1035780384 8:2223072-2223094 TAGGCACAGCGCCTGAATACAGG + Intergenic
1036962009 8:13254877-13254899 AGGGCACCGATCCTGGAAATTGG + Intronic
1037525290 8:19718384-19718406 GAGCCACCGAGCCTGGCCACAGG + Intronic
1044938189 8:97313158-97313180 AAGGCACTGAGCCTAGAGAGAGG - Intergenic
1047423437 8:124726281-124726303 GAAGAACCGAGCCTGGATTCTGG + Intronic
1049061494 8:140279602-140279624 ACGGCACCGAGCCTGGGCCCTGG - Intronic
1056601693 9:88051892-88051914 AAGCCATCGTGCCTGGCTACAGG - Intergenic
1203771214 EBV:50965-50987 AAGGCACCAACCCTGGAATCTGG + Intergenic
1203424686 Un_GL000195v1:26805-26827 AAGCCACCGTGCCTGGCTAGGGG + Intergenic
1203372428 Un_KI270442v1:321324-321346 ATGGCGCCGAGCCTGCTTACAGG - Intergenic
1187959235 X:24552645-24552667 AAAGCACCCAGCCTGGTGACTGG - Intergenic
1190151428 X:47953450-47953472 ACTGCACCCAGCCTGAATACTGG - Intronic
1192372931 X:70530058-70530080 AAGGGACATAGCATGGATACAGG - Intronic
1193082808 X:77422521-77422543 AAGTCACAGAGCATGCATACAGG + Intergenic