ID: 1021551202

View in Genome Browser
Species Human (GRCh38)
Location 7:21872856-21872878
Sequence GAGGGTGTCAGGCACATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 190}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021551198_1021551202 -5 Left 1021551198 7:21872838-21872860 CCATCAGAAACCAATGAAGAGGG 0: 1
1: 0
2: 2
3: 14
4: 197
Right 1021551202 7:21872856-21872878 GAGGGTGTCAGGCACATTTCTGG 0: 1
1: 0
2: 0
3: 15
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021551202 Original CRISPR GAGGGTGTCAGGCACATTTC TGG Intronic
901077788 1:6566241-6566263 GAGGGTGTCAGGGTCAGTCCAGG + Intronic
903226341 1:21896021-21896043 CTGGGTGTCAGGCACTGTTCTGG + Intronic
905027715 1:34862605-34862627 GAAGGTGTCACTCAGATTTCTGG - Intergenic
907419319 1:54336321-54336343 GAGGGCTTCAGGAAGATTTCCGG - Intronic
907581311 1:55575061-55575083 GAGGGTGTTAGGAACAATTGTGG - Intergenic
908025425 1:59946240-59946262 GAGGGTACCTGGCACATTTAAGG - Intergenic
908196064 1:61746474-61746496 GAGAGTGTCAGAGATATTTCTGG + Intronic
911144034 1:94535404-94535426 GAGGGTGACAGGCAGATGGCTGG + Intronic
913193395 1:116432557-116432579 GAGGGAGTCAGGCAGGTTTGGGG - Intergenic
914195892 1:145448005-145448027 GATGGTGGCAGGCACTTCTCAGG - Intergenic
920136241 1:203771527-203771549 GAGGGTGAGAGGCACATTCTGGG - Intronic
1064643688 10:17438997-17439019 GAGGCTGTGAAGCACATTTTGGG - Intronic
1065231783 10:23605899-23605921 GAGGAGCTCAGGCATATTTCTGG + Intergenic
1069940823 10:71954153-71954175 GAGGGTGTCAGGGTCAGTCCAGG + Intergenic
1073458811 10:103653806-103653828 GAGGGTGGCAGGCACAGGTGTGG - Intronic
1073974543 10:109086013-109086035 GATGGTGACAGGCACACATCAGG - Intergenic
1079537637 11:21534070-21534092 GAGGGTGTTTGGCACAGTTTTGG - Intronic
1079946829 11:26753857-26753879 TAGGGTGTGTGGCCCATTTCTGG - Intergenic
1081385197 11:42463896-42463918 GAGGAAGCCAGTCACATTTCAGG + Intergenic
1083340418 11:61955475-61955497 GAGGGGGTCTGGCGGATTTCTGG + Intronic
1083341447 11:61960942-61960964 GAGAGTGTTGGGCACATGTCAGG + Intronic
1084522327 11:69671555-69671577 GAAAGTGCCAGGCACATTTTAGG - Intronic
1084793686 11:71490614-71490636 GGGGATGGCAGGCAGATTTCGGG - Intronic
1089457994 11:118636522-118636544 GTGTGTGTCAGGCACCTTGCTGG + Intronic
1090446043 11:126765679-126765701 AAGGGAGTCAGGCAGTTTTCGGG + Intronic
1090486906 11:127121206-127121228 GAGGCTATCAGGCACATCTCTGG - Intergenic
1090719729 11:129460257-129460279 CAGGGGGTCAGGAACATTTGAGG + Intergenic
1091786315 12:3245260-3245282 GAAGGTGCCAAGCCCATTTCTGG + Intronic
1092255040 12:6922253-6922275 GAGGGTGTCAGGGGAGTTTCAGG + Intronic
1092864862 12:12751260-12751282 GAGGATGTCAGCCACACCTCTGG + Intronic
1093077269 12:14770939-14770961 GGGGGCGTCAAGCGCATTTCTGG - Exonic
1093684706 12:22042980-22043002 AACTGTGTCAGGCACTTTTCTGG - Intergenic
1095537000 12:43261015-43261037 GAGGGTCCCAGGCACCTCTCTGG - Intergenic
1097241152 12:57576161-57576183 GAAGGTGTCAGGGACAATTGGGG + Intronic
1099945085 12:89234855-89234877 GAGGGAGCCAGGCAGATATCTGG - Intergenic
1103394266 12:120596004-120596026 CAGGGTATCATCCACATTTCTGG + Intergenic
1104745028 12:131205110-131205132 GAAGGTGTCTGGCACAAGTCAGG - Intergenic
1105892954 13:24695182-24695204 GAGGGAGTGCGGCACAGTTCAGG + Intronic
1111323441 13:86661239-86661261 GAGTCTGTAAGGCTCATTTCAGG + Intergenic
1111758928 13:92436835-92436857 AAGTGTGTCAGGCACAGTGCTGG - Intronic
1112051795 13:95649986-95650008 GAGGCTGCCATGCCCATTTCAGG - Intergenic
1114902998 14:27088966-27088988 GAGGGTAGTATGCACATTTCTGG + Intergenic
1115504795 14:34083357-34083379 GAGGGTGTTACCCACAATTCTGG - Intronic
1115527788 14:34299033-34299055 GAGGGTGCCATGCACGTTTCTGG + Intronic
1119104079 14:71907518-71907540 GAGGGTCTCGGGCACAGGTCAGG + Intergenic
1121527662 14:94630600-94630622 GAGGGCGTCATGCATGTTTCTGG - Intergenic
1121555576 14:94834060-94834082 GAGTGTCTCAGACACATCTCAGG + Intergenic
1121734496 14:96208556-96208578 GGGGATGTCAGGCACACTGCAGG + Intronic
1121974726 14:98392356-98392378 GATGGGGTGAGGGACATTTCTGG - Intergenic
1123899544 15:24862841-24862863 CAGTGTGTCTGGCACAGTTCAGG + Intronic
1128091802 15:64924139-64924161 GAGGGTCTCACTCACATGTCTGG + Intronic
1128426831 15:67550519-67550541 GATGGTGACAGGAACACTTCAGG + Intronic
1128712465 15:69882582-69882604 AAGGGTGTCAGGCTGCTTTCAGG + Intergenic
1129151581 15:73691937-73691959 GAAGCTGTCAGGGATATTTCAGG + Intronic
1130137803 15:81196573-81196595 CAGCGTGCCAGGCACATTGCAGG + Intronic
1130573237 15:85067966-85067988 GAGGAACACAGGCACATTTCAGG - Intronic
1133704428 16:8339985-8340007 GAGGGTGCCAGGCACATAATAGG - Intergenic
1133989557 16:10694207-10694229 GAAGGTGGCAGGCACCTTGCAGG - Intronic
1134433392 16:14233340-14233362 GAGGGTGTAAAGCACATTTATGG + Intronic
1134851591 16:17483283-17483305 GAGGGAGACAGGCAGATATCTGG - Intergenic
1137571104 16:49566828-49566850 GAGGGTGTCAGGGAATTTTGGGG + Intronic
1138567680 16:57845519-57845541 GAGGCTGTCTGGCAGATTTTAGG - Intronic
1139525346 16:67512394-67512416 GAGGGAGTCAGGCAGATGACAGG + Intergenic
1141179594 16:81743488-81743510 GAAGGAGTGAGGGACATTTCCGG + Intronic
1142195823 16:88738895-88738917 GAAGGTGTCAGGCAGACCTCAGG - Intronic
1144949157 17:18984793-18984815 GAGGGTGTCAGTGAAAGTTCTGG + Intronic
1145397004 17:22504277-22504299 GTGGGTGTGAGGCACATGCCAGG + Intergenic
1145896687 17:28462365-28462387 TAGGGTGTCAGGCACTATGCTGG - Intronic
1145960066 17:28882038-28882060 GAGGGTGTGTGGCACATTAGAGG + Intronic
1146612462 17:34319801-34319823 GTGGGTGTAAAGGACATTTCAGG + Intronic
1147161615 17:38572308-38572330 GAGGGTGTCATCCACACATCTGG - Intronic
1147542057 17:41368602-41368624 GAGAGTGTTAGGCACAGTGCTGG - Intronic
1148969980 17:51471288-51471310 CATGGTGTCAGGCACATAGCTGG + Intergenic
1150345870 17:64404298-64404320 CGGGGTGTCAGGTACTTTTCAGG - Intronic
1152376293 17:79920456-79920478 GTGGGTGGCAGGGTCATTTCAGG + Intergenic
1152844520 17:82591521-82591543 CTTGGTGCCAGGCACATTTCTGG - Intronic
1153291432 18:3505725-3505747 CAGGGTGTCAGGCACATGTTAGG + Intronic
1153468361 18:5415307-5415329 GAGGGTGGTGGGGACATTTCAGG + Intronic
1153753168 18:8254210-8254232 GCAGCTGTCAGGGACATTTCTGG + Intronic
1158673784 18:59500541-59500563 GAGGGTGTCATTGACAGTTCTGG - Intronic
1161135260 19:2615892-2615914 CACTGTGTCAGGCACATTGCTGG - Intronic
1162300440 19:9841998-9842020 GAGGGTGTCTCGCCCATCTCTGG + Intronic
1163263694 19:16206012-16206034 GAGGGAGTGAGGCTCATTCCAGG - Intronic
1163413770 19:17173093-17173115 CAGGGTGACAGGAACACTTCAGG - Intronic
1166708631 19:44923123-44923145 GAGGGAGCCAGGCAGATATCTGG - Intergenic
1166710630 19:44934919-44934941 GAGGGAGCCAGGCAGATATCTGG - Intergenic
925132305 2:1502759-1502781 CAGGGTGTCAGGGATATCTCAGG - Intronic
925171320 2:1751909-1751931 GAGGGTGGAAGGCTCATGTCTGG + Intergenic
926076235 2:9945403-9945425 GACAATGCCAGGCACATTTCAGG - Intergenic
928607072 2:32952886-32952908 GCGGGTGCCTGGCACATTGCAGG + Intronic
929139698 2:38656085-38656107 GGGGGTGTCAGATACACTTCAGG - Intergenic
935267117 2:101404276-101404298 GATGTTGTCAGGCTCACTTCAGG - Intronic
935542423 2:104364666-104364688 GATGTTGTCAGTCACATTTTCGG - Intergenic
937125007 2:119469241-119469263 GAGGGTGTCAGCCTCACTCCTGG + Intronic
937231335 2:120399816-120399838 CAGTGTGTCAGGCACTGTTCTGG + Intergenic
938033410 2:128015369-128015391 GAGAATGTAAGGGACATTTCAGG - Intronic
939871235 2:147528083-147528105 GGGGGTGGGAGGCACATTGCTGG + Intergenic
941722485 2:168826688-168826710 AATGAAGTCAGGCACATTTCTGG - Intronic
945894502 2:215466960-215466982 GAGGGAGGCAGCCACATTTCTGG - Intergenic
948590662 2:239047629-239047651 GAGGGGCTCAGGCACTTTCCGGG + Intergenic
1169296909 20:4407967-4407989 GATGGTGTCATTCACATGTCTGG + Intergenic
1169540230 20:6591855-6591877 GGAGAAGTCAGGCACATTTCCGG - Intergenic
1172362626 20:34324690-34324712 GAACGTGTCTGGCACATTCCGGG + Intergenic
1172584431 20:36072679-36072701 GTGGGTATCAGGCAGATTTCTGG + Intergenic
1172635166 20:36405466-36405488 GAGGGAGGCTGGGACATTTCTGG + Intronic
1172668033 20:36614209-36614231 GAGTGTGACAGGTACATTCCGGG + Intronic
1173415777 20:42854523-42854545 GTGGGTGCAAGGCACATGTCAGG - Intronic
1173691142 20:44962068-44962090 GAGAGTCTCAGGCAAAATTCAGG - Intergenic
1173984460 20:47250356-47250378 GAGGGTGGCAGGCACAGTGGAGG - Intronic
1174190518 20:48737304-48737326 GAGGGTCCCAGGCAGATTTTGGG + Intronic
1175621689 20:60453016-60453038 GAATGTGTCAGGCACAGTACTGG - Intergenic
1178256571 21:31057917-31057939 GAGTGTTTCAGTCACCTTTCAGG - Intergenic
1179472303 21:41619862-41619884 CAGGGTGCCAGGCACTATTCTGG + Intergenic
1180096595 21:45558209-45558231 GTGGGTGTCATGCACTTGTCTGG - Intergenic
1181556150 22:23672731-23672753 GAGTGAGGCTGGCACATTTCTGG - Intergenic
1181998953 22:26904457-26904479 GAGCTGGTCAGGCTCATTTCAGG - Intergenic
1183539376 22:38420807-38420829 CATGGTGTCAGGTACATTACTGG - Intergenic
1184236147 22:43184106-43184128 GGGGGTGTCATCCACCTTTCAGG + Intronic
1185033907 22:48460862-48460884 GAGGATGTGAGGCAGATTTGGGG + Intergenic
1185247212 22:49779560-49779582 GGGGGTGTCATACTCATTTCTGG + Intronic
952134044 3:30397130-30397152 GAGGGTTTCAGGCAAACTCCAGG + Intergenic
952873629 3:37923251-37923273 GAGGGTGGTATCCACATTTCTGG + Intronic
954763175 3:52891868-52891890 GTTGGTGTCAGGCACATGTTAGG - Intronic
956723699 3:72139686-72139708 GATGGTGTCAGGCACTCATCTGG - Intergenic
961398315 3:126614382-126614404 GAAGATGTCAGGCACATGACAGG - Intronic
962710563 3:138082165-138082187 GAAGGAGTCAGACACATTCCCGG + Intronic
962829738 3:139129572-139129594 CATGGTGTCTGGCCCATTTCAGG + Intronic
965731334 3:171775076-171775098 AAGGGTGTCAGACAGAATTCAGG + Intronic
969136006 4:5029384-5029406 GAGGGAGTCAGAGAAATTTCAGG + Intergenic
969218976 4:5747040-5747062 GAGGGTGTCAGGCAGGTTTGAGG + Intronic
969346784 4:6575172-6575194 GAAGGTGCCAGGCCCACTTCCGG - Exonic
969664754 4:8550819-8550841 GACGCTGTCAGGCCCAGTTCGGG + Intergenic
971024374 4:22573877-22573899 GAGGGTTTCACTCACATTTCTGG + Intergenic
971083536 4:23243892-23243914 GATGGTGTAAATCACATTTCTGG - Intergenic
972928150 4:44038167-44038189 GAGGATGTCAGGCACTTATGAGG + Intergenic
976362886 4:84201163-84201185 GAGGGAGTCAGACACATATATGG - Intergenic
977435825 4:96992901-96992923 GAGGATCACAGGCACATCTCAGG - Intergenic
982269691 4:153573673-153573695 CAGGGTTTCTGGCACATTTCAGG + Intronic
983034554 4:162847740-162847762 GAGAGTGTCTGGCACATTGTAGG - Intergenic
985174888 4:187190191-187190213 GTGGAAGTCAGGCATATTTCAGG + Intergenic
985395789 4:189542183-189542205 GAAGGTGTGTGGCTCATTTCTGG - Intergenic
987859057 5:23460278-23460300 TAGGGTGTCAGGAACAATTTTGG + Intergenic
990458972 5:56014874-56014896 GGGGGTGTCAGCCCCATGTCCGG - Intergenic
996143197 5:119940525-119940547 GAAAGTGAAAGGCACATTTCAGG - Intergenic
996897112 5:128498069-128498091 CAGTGTGTCAGACACATTACTGG + Intronic
999151677 5:149430462-149430484 GAGGGTTTCCGGTACTTTTCAGG + Intergenic
999989680 5:157038289-157038311 CAGGAAGCCAGGCACATTTCAGG - Intronic
1000429695 5:161136451-161136473 GAGGTTTGCAGTCACATTTCTGG - Intergenic
1002682395 5:180976988-180977010 GGGGGTGGCAGACAGATTTCTGG + Intergenic
1003366551 6:5480610-5480632 GACGGTTTCAAGCACATTTTGGG + Intronic
1004285842 6:14319899-14319921 GAGAGTGTCTGGCACATGTCTGG + Intergenic
1004357567 6:14943371-14943393 GAGGGTGTCAGGGAGACTTCAGG - Intergenic
1005475619 6:26204768-26204790 GGGGGTGTCAAGCGCATTTCTGG + Exonic
1006931044 6:37688663-37688685 GAGGGTGGCAGGCAGATGGCAGG - Intronic
1007832469 6:44649006-44649028 GAGGGTGGAAGGCTCATTTGTGG - Intergenic
1008143430 6:47859582-47859604 AAGGGTGCCAGGCACATGTTAGG - Intergenic
1011018732 6:82787440-82787462 GATGGTGTAAAGCACACTTCAGG - Intergenic
1011323944 6:86128855-86128877 GAGTGTGTCTGGCTCCTTTCAGG - Intergenic
1012503176 6:99913517-99913539 GAGGGTATCATCCACATGTCTGG + Intergenic
1012742017 6:103029085-103029107 AAGGGTTTGAGGAACATTTCTGG + Intergenic
1016319792 6:142830420-142830442 GAGGCTGGGAGGCACACTTCTGG + Intronic
1017245695 6:152222222-152222244 GAGGGTGCCACTCACACTTCTGG - Intronic
1019628186 7:2032069-2032091 CAGGGTGCCAGGCACACTCCGGG + Intronic
1020787848 7:12592108-12592130 GAGGGTGTCAGGGTCAGTCCAGG + Intronic
1021551202 7:21872856-21872878 GAGGGTGTCAGGCACATTTCTGG + Intronic
1022410045 7:30132422-30132444 GAGGCTGTCCTGCACATTGCAGG - Intergenic
1023998267 7:45175173-45175195 GTGGGGGTCAGGGACATTCCAGG + Intronic
1024197348 7:47072337-47072359 GGGGTTGTCAGGCACATACCTGG + Intergenic
1027569073 7:79840126-79840148 GTGTGTGTCATGCACATTTATGG - Intergenic
1028115173 7:86988727-86988749 GAGGGGGTCAGGCACACTCAAGG - Intronic
1028613768 7:92740801-92740823 GTGTGTGTTAGGCACCTTTCTGG - Intronic
1029935462 7:104420144-104420166 CAGGGTGGAAGGCACTTTTCTGG + Intronic
1030278372 7:107743976-107743998 GAGGGACTCAGGCATAGTTCGGG - Exonic
1032314572 7:130823360-130823382 GATGGTGTCAAGAGCATTTCTGG - Intergenic
1033611055 7:142963543-142963565 GAGAGAGGCAAGCACATTTCTGG + Intergenic
1033948353 7:146751442-146751464 GACTGAGTCTGGCACATTTCTGG + Intronic
1034334315 7:150310656-150310678 GTGGGTGTCAGGGTCAGTTCAGG - Intronic
1035215220 7:157361117-157361139 GAGGATTTCTGGCACATTTAGGG + Intronic
1037542001 8:19880982-19881004 GAGGGTGTCCAGCAGATTCCAGG + Intergenic
1037717614 8:21413060-21413082 GAGGATGTAGGGCACATTTGAGG + Intergenic
1040499695 8:47995824-47995846 GAGGGTGTCAGGGTCAGTCCAGG + Intergenic
1042748566 8:72133834-72133856 GAGGGTGTCAGGGTCAGTCCAGG + Intergenic
1047622818 8:126625086-126625108 GTGAGTGTCAGGCACTTTGCGGG - Intergenic
1051109255 9:13616833-13616855 GAGAGTGTCAGGCTAAATTCAGG - Intergenic
1051926393 9:22332198-22332220 GAGTGTTCCAGGCACATTTAAGG - Intergenic
1053283527 9:36836547-36836569 CAGGGGGGCAGGCACACTTCTGG + Exonic
1053510016 9:38679776-38679798 GAGGGTGTAAGGCACATGGTTGG - Intergenic
1055704695 9:78984872-78984894 GAGTTTGTCAAGCACAATTCAGG + Intergenic
1055967229 9:81877215-81877237 GAGGGAGTGACGCACAGTTCCGG + Intergenic
1057054909 9:91952783-91952805 GAGGGAGCCATGCACATATCTGG + Intergenic
1057800491 9:98188176-98188198 GGGTGAGTCAGGCTCATTTCTGG - Intronic
1057813133 9:98273250-98273272 ATGGGTGTCAGGCACTTTTGGGG + Intergenic
1058677558 9:107413348-107413370 GAGGGTCTCAAGCACATTATTGG + Intergenic
1060783017 9:126427307-126427329 GTGGGTGTCAGGCACCTTATGGG + Intronic
1060785890 9:126451404-126451426 GAGGGTGTCAGGGACAGGTCAGG + Intronic
1062337426 9:136078332-136078354 GAGGGGGACAGGCACATCTGGGG + Intronic
1062412590 9:136432498-136432520 GTTGGTGTCGGGCACATTTCTGG + Exonic
1062698840 9:137888817-137888839 GATGGTGGCAGGCACTTCTCAGG + Intronic
1186854690 X:13614707-13614729 GAGGGTCTTTGGCACATTTGGGG - Intronic
1190303366 X:49068808-49068830 CAGGGTGTCAGACACCTTCCTGG - Intronic
1194227586 X:91280040-91280062 GAGGGTGTCAGGGTCCTCTCCGG + Intergenic
1196785627 X:119419218-119419240 GAGGGTGTCAGGCAGAGTTGTGG - Intronic
1197321819 X:125041755-125041777 GAGAATTTCAGGCACATTACAGG + Intergenic
1197853513 X:130889934-130889956 GAAGGTGTCAGTCCAATTTCAGG + Intronic
1200000422 X:153056993-153057015 CAGGGCGTGAGGCACATATCTGG - Intronic
1201277553 Y:12313076-12313098 GAGAGTGGAAGGCACATTCCTGG + Intergenic