ID: 1021555307

View in Genome Browser
Species Human (GRCh38)
Location 7:21912757-21912779
Sequence TCTCTCGTGCAGGAGGTGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021555297_1021555307 24 Left 1021555297 7:21912710-21912732 CCATGGGGGCCTGATGGAAAGCT 0: 1
1: 0
2: 1
3: 13
4: 155
Right 1021555307 7:21912757-21912779 TCTCTCGTGCAGGAGGTGAGAGG No data
1021555298_1021555307 15 Left 1021555298 7:21912719-21912741 CCTGATGGAAAGCTCATTCAAGG 0: 1
1: 0
2: 0
3: 6
4: 111
Right 1021555307 7:21912757-21912779 TCTCTCGTGCAGGAGGTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021555307 Original CRISPR TCTCTCGTGCAGGAGGTGAG AGG Intronic
No off target data available for this crispr