ID: 1021555749

View in Genome Browser
Species Human (GRCh38)
Location 7:21916004-21916026
Sequence ACGTGGGCCACTGTAAGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021555749_1021555753 26 Left 1021555749 7:21916004-21916026 CCAGAACTTACAGTGGCCCACGT 0: 1
1: 0
2: 1
3: 7
4: 104
Right 1021555753 7:21916053-21916075 TAATTAACTGCTTCCCTTCCTGG 0: 1
1: 0
2: 2
3: 7
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021555749 Original CRISPR ACGTGGGCCACTGTAAGTTC TGG (reversed) Intronic
900433803 1:2617014-2617036 AAGTGAGGCACTGTAAGTTAAGG - Intronic
904423651 1:30409862-30409884 GCCTGGGCCGCTGGAAGTTCAGG - Intergenic
905526294 1:38642387-38642409 ATTTGGGCCACTGTCAGTTTAGG + Intergenic
917230489 1:172832108-172832130 AAGTGAGCCACTGTAACTTATGG + Intergenic
921191074 1:212709163-212709185 ACCTGGGCCATAGAAAGTTCTGG + Intergenic
921808889 1:219489111-219489133 ACCTGGGCCCCTGAAAGTACTGG - Intergenic
922229351 1:223672307-223672329 ACGTTGGCCTCTCAAAGTTCTGG - Intergenic
923627853 1:235628598-235628620 ACCTGGTCCTGTGTAAGTTCTGG + Intronic
923851860 1:237804726-237804748 ACGTGAGCCACAGTAAGTCTAGG - Intronic
924397582 1:243639653-243639675 ACGGGGGAAACTGTCAGTTCTGG + Intronic
1064176016 10:13075797-13075819 ACCTTGGCCACTGAAAGTGCTGG - Intronic
1064798235 10:19038556-19038578 AAGAGGGCCACTGGAAGATCTGG + Intergenic
1069619592 10:69828567-69828589 AAGTGGGACACTGTAAGTTCTGG - Intronic
1069753273 10:70758318-70758340 ACCAGGGCCACTGAAAGGTCTGG - Intronic
1072155630 10:92721227-92721249 ACCTTGGCCACTGTAAGTACTGG - Intergenic
1072352856 10:94575377-94575399 ACGTGAGCCACTGTACCTCCCGG + Intronic
1074605495 10:114960292-114960314 AGGTGGGCCCCAGTGAGTTCTGG - Intronic
1075539596 10:123300940-123300962 ACGTTGGCCTCTGAAAGTGCTGG + Intergenic
1083606974 11:63984816-63984838 ACGTCGGCCTCTGAAAGTGCTGG - Intronic
1083808667 11:65089970-65089992 ACCTGGGCCTCTGAAAGTGCTGG - Intronic
1085675931 11:78518257-78518279 ACGTGGGCATCTGCAAGTTTTGG + Intronic
1094027228 12:25971404-25971426 ACTTGGCCCAATGTTAGTTCAGG - Intronic
1094318642 12:29160180-29160202 ACTTTGGCCACTGTCAGTTCAGG + Intronic
1096169576 12:49456468-49456490 ACTTAGGCCACTGTAAGGACTGG + Intronic
1099190932 12:79561578-79561600 ACGCGGGCCAGCGTGAGTTCTGG + Intergenic
1101083467 12:101211834-101211856 AATTGGGCTACTGTAAGTTATGG + Intergenic
1101414691 12:104498994-104499016 TAGTGAGCCACTGAAAGTTCTGG - Intronic
1114679550 14:24473187-24473209 TCGGGGGCCAGTGTGAGTTCCGG + Intergenic
1115533262 14:34346122-34346144 TAGTGGGCCAGTGTGAGTTCTGG - Intronic
1118047232 14:61983775-61983797 ACGTTGGCCACTCAAAGTCCAGG + Intergenic
1120351496 14:83365671-83365693 AAGTCGGCCACTGTTAGTTTGGG - Intergenic
1126570925 15:50149849-50149871 ACCTTGGCCTCTGAAAGTTCTGG - Intronic
1127241049 15:57114545-57114567 ACTTGGGCCTCTGAAAGTGCTGG + Intronic
1128561735 15:68673073-68673095 ATGGGGGCCACTGTGAGTGCTGG + Intronic
1130436053 15:83901123-83901145 ACGTGGACCACTGTCAGTGCTGG + Intronic
1131630362 15:94169938-94169960 ACGTTGGCCTCTCAAAGTTCTGG + Intergenic
1134323807 16:13188466-13188488 ACGTTGGCCTCTGAAAGTGCTGG - Intronic
1135241318 16:20808850-20808872 ACCTTGGCCTCTGCAAGTTCTGG + Intronic
1135590215 16:23699670-23699692 ACCTTGGCCTCTGAAAGTTCTGG + Intronic
1136057739 16:27702915-27702937 ACCTGGGCCTCCGTAAGTGCTGG - Intronic
1138243755 16:55450329-55450351 ACGTCGGCCTCTGAAAGTGCTGG + Intronic
1141289056 16:82700927-82700949 ACGTGCACCATTGTAAGTGCTGG + Intronic
1142168278 16:88605344-88605366 ACGCTGGCCACTGAAAGTGCAGG - Intronic
1142295781 16:89221141-89221163 ACCTGGCCCACGGTAAGTCCTGG + Exonic
1142950294 17:3472624-3472646 ACCTGGCCCATAGTAAGTTCCGG - Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1151760072 17:76096262-76096284 GCCTCGGCCTCTGTAAGTTCTGG - Intronic
1157277716 18:46323621-46323643 GCCTGGGCCTCTGAAAGTTCTGG + Intergenic
1161064695 19:2231858-2231880 ACGCAGGCCACCGTATGTTCAGG + Exonic
1162616012 19:11800771-11800793 ACCTGGGCCTCTGAAAGTGCTGG - Intronic
925257345 2:2501332-2501354 ACGTGGCTCACTGTCAGATCAGG - Intergenic
926226891 2:10973141-10973163 ATGGGAGCCACTGTAAGTTTGGG + Intergenic
926532033 2:14060310-14060332 ACCTCGGCCACTGTAAGTGCTGG - Intergenic
929617652 2:43324677-43324699 AAATGGTGCACTGTAAGTTCAGG + Intronic
930615989 2:53594181-53594203 ACCTGGGACAGTCTAAGTTCTGG + Intronic
931180479 2:59895304-59895326 ATGTGGGCCAGTCTAAGTTAAGG - Intergenic
937136554 2:119558566-119558588 ACGTTGGCCTCTGAAAGTGCTGG - Intronic
938146110 2:128836006-128836028 ACGGGGGCCACTTTAGGTTCAGG - Intergenic
939035595 2:137127344-137127366 TGGTGTGCCACTGTAAGTTAGGG - Intronic
946945335 2:224815784-224815806 ACGTCGGCCTCTGAAAGTGCTGG - Intronic
1170658051 20:18309034-18309056 AGGTGGCCATCTGTAAGTTCAGG - Intronic
1175342519 20:58242853-58242875 ACTTGGACCACTTTAAGTTGGGG - Intergenic
1180675350 22:17582503-17582525 ACCTGGGGCACTGTTATTTCTGG + Intronic
951491261 3:23272326-23272348 TCTTGGGCCAGTGAAAGTTCTGG - Intronic
953266650 3:41396157-41396179 ACATGGGCTCCTGTGAGTTCAGG - Intronic
959297608 3:104557058-104557080 AGGTGGGCCAATGTAATTACAGG - Intergenic
960479513 3:118171436-118171458 TCGTGGGCCACCGCGAGTTCCGG + Intergenic
966186186 3:177228902-177228924 ACCTGGGCCAGCGTGAGTTCCGG - Intergenic
968013683 3:195305878-195305900 AAGTTGGCCACGGTAAGTTTTGG + Intronic
969716258 4:8869721-8869743 ACATGGGCCTCTGTGAGTTTGGG - Intronic
970091689 4:12415740-12415762 AGTTGAGCCACTGTAAGTTGGGG - Intergenic
971663701 4:29455308-29455330 ACCTGGACCACTGAAAGTGCTGG - Intergenic
974838256 4:67275566-67275588 TCGTGGGCCAGTGCGAGTTCCGG - Intergenic
974839371 4:67283142-67283164 TCATGGGCCAGTGTGAGTTCTGG - Intergenic
977641138 4:99359713-99359735 TCATGGGCCAGTGTGAGTTCCGG + Intergenic
979051149 4:115934696-115934718 ACGTTGGCCTCTGAAAGTGCTGG + Intergenic
982989075 4:162247324-162247346 ACCTCGGCCTCTGAAAGTTCTGG + Intergenic
983397603 4:167220633-167220655 ACCTTGGCCTCTGGAAGTTCTGG + Intronic
985377262 4:189354794-189354816 GCCTTGGCCACTGTAAGTGCTGG - Intergenic
989270897 5:39531681-39531703 AGGTGGGCCATGGTCAGTTCAGG + Intergenic
1010269318 6:73903198-73903220 TCGTGGGCCAGCGTGAGTTCTGG + Intergenic
1010270343 6:73910027-73910049 TCGAGGGCCAGTGTGAGTTCTGG + Intergenic
1019454874 7:1121753-1121775 TCGTGGGCCACAGTAAGCCCAGG - Intronic
1020212026 7:6164804-6164826 ACCTGGGCCACGGTATGCTCTGG + Exonic
1021555749 7:21916004-21916026 ACGTGGGCCACTGTAAGTTCTGG - Intronic
1023997603 7:45171403-45171425 ACCTTGGCCTCTGAAAGTTCTGG + Intronic
1024373467 7:48612004-48612026 GTCTGGGCCACTGTAAGTTGAGG - Intronic
1025746522 7:64247798-64247820 ACCTCGGCCACTGAAAGTGCAGG + Intronic
1027904653 7:84164092-84164114 ACCTTGGCCTCTGAAAGTTCTGG + Intronic
1028912959 7:96228746-96228768 TCGTGGGCCAGCGTGAGTTCTGG + Intronic
1029658553 7:101943866-101943888 ACCTCGGCCTCTGTAAGTGCTGG - Intronic
1032864116 7:135909032-135909054 GTGAGGGCCACTGTGAGTTCTGG + Intergenic
1033707719 7:143905131-143905153 ACCTGGGCCAGTGCGAGTTCTGG + Intergenic
1037205235 8:16309522-16309544 ACGTAAGCCAATGGAAGTTCTGG + Intronic
1042336001 8:67630763-67630785 TAGTGGGCCAGTGTGAGTTCCGG + Intronic
1042948787 8:74179838-74179860 TCACGGGCCACTGCAAGTTCTGG - Intergenic
1043144686 8:76638252-76638274 ACCTAAGCCTCTGTAAGTTCTGG - Intergenic
1044679735 8:94764975-94764997 ACTTTGGCCACTGAAAGTGCTGG + Intronic
1045306051 8:100957430-100957452 TTGTGGGCCACCGCAAGTTCCGG - Intergenic
1046251857 8:111642890-111642912 TTGTGGGCCAGTGCAAGTTCCGG + Intergenic
1048186913 8:132249978-132250000 TCGTGGGCCAGCGCAAGTTCCGG - Intronic
1057130916 9:92654121-92654143 ACCTGGGTGACTGTGAGTTCAGG - Intronic
1057634027 9:96746537-96746559 ACTTGGGCCTCCGTAAGTGCTGG - Intergenic
1057775659 9:98006741-98006763 ACCTCGGCCTCTGTAAGTGCTGG - Intronic
1058379596 9:104363222-104363244 TCGTGGGCCAACGTGAGTTCTGG - Intergenic
1059161339 9:112038182-112038204 ACGTGCCCCACTGCAATTTCAGG + Intergenic
1061508898 9:131048678-131048700 ACATGGGCCACTGGAAGGACAGG + Intronic
1186823459 X:13314584-13314606 ACATGGGCCACTTGAAGTTCAGG + Intergenic
1189048789 X:37621726-37621748 AGGTGGGCCACTTGGAGTTCAGG - Intronic
1191819801 X:65292733-65292755 ACCTTGGCCTCTGAAAGTTCTGG - Intergenic
1192022439 X:67408699-67408721 TCGTGGGCCAGCGTGAGTTCTGG + Intergenic
1195025812 X:100876452-100876474 ACGTGGGCCTCTCAAAGTGCTGG + Intergenic
1202090482 Y:21183459-21183481 TCGTGGGCCAGTGCAGGTTCTGG + Intergenic