ID: 1021559459

View in Genome Browser
Species Human (GRCh38)
Location 7:21955469-21955491
Sequence ATGTGGCTATAGAGGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021559459_1021559470 19 Left 1021559459 7:21955469-21955491 CCTGTTGCCCTCTATAGCCACAT No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021559459 Original CRISPR ATGTGGCTATAGAGGGCAAC AGG (reversed) Intergenic
No off target data available for this crispr