ID: 1021559470

View in Genome Browser
Species Human (GRCh38)
Location 7:21955511-21955533
Sequence CTTCCTCCTTCCTTAACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021559464_1021559470 -7 Left 1021559464 7:21955495-21955517 CCTTCCTCCCACATCCCTTCCTC No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559459_1021559470 19 Left 1021559459 7:21955469-21955491 CCTGTTGCCCTCTATAGCCACAT No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559463_1021559470 -4 Left 1021559463 7:21955492-21955514 CCACCTTCCTCCCACATCCCTTC No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559457_1021559470 21 Left 1021559457 7:21955467-21955489 CCCCTGTTGCCCTCTATAGCCAC No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559458_1021559470 20 Left 1021559458 7:21955468-21955490 CCCTGTTGCCCTCTATAGCCACA No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559456_1021559470 22 Left 1021559456 7:21955466-21955488 CCCCCTGTTGCCCTCTATAGCCA No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559461_1021559470 11 Left 1021559461 7:21955477-21955499 CCTCTATAGCCACATCCACCTTC No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559460_1021559470 12 Left 1021559460 7:21955476-21955498 CCCTCTATAGCCACATCCACCTT No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data
1021559462_1021559470 2 Left 1021559462 7:21955486-21955508 CCACATCCACCTTCCTCCCACAT No data
Right 1021559470 7:21955511-21955533 CTTCCTCCTTCCTTAACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021559470 Original CRISPR CTTCCTCCTTCCTTAACCCC TGG Intergenic
No off target data available for this crispr