ID: 1021565040

View in Genome Browser
Species Human (GRCh38)
Location 7:22008444-22008466
Sequence CTATTCCTGAAACGAGTGTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021565040_1021565043 17 Left 1021565040 7:22008444-22008466 CCTAACACTCGTTTCAGGAATAG No data
Right 1021565043 7:22008484-22008506 TAGTGCATTTCTGTATTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021565040 Original CRISPR CTATTCCTGAAACGAGTGTT AGG (reversed) Intergenic
No off target data available for this crispr