ID: 1021566886

View in Genome Browser
Species Human (GRCh38)
Location 7:22024938-22024960
Sequence CACTGCCCAACAGTGCAACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021566884_1021566886 -8 Left 1021566884 7:22024923-22024945 CCATGCTGTGCTCAGCACTGCCC No data
Right 1021566886 7:22024938-22024960 CACTGCCCAACAGTGCAACTGGG No data
1021566883_1021566886 -3 Left 1021566883 7:22024918-22024940 CCATGCCATGCTGTGCTCAGCAC No data
Right 1021566886 7:22024938-22024960 CACTGCCCAACAGTGCAACTGGG No data
1021566882_1021566886 -2 Left 1021566882 7:22024917-22024939 CCCATGCCATGCTGTGCTCAGCA No data
Right 1021566886 7:22024938-22024960 CACTGCCCAACAGTGCAACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021566886 Original CRISPR CACTGCCCAACAGTGCAACT GGG Intergenic
No off target data available for this crispr