ID: 1021571369

View in Genome Browser
Species Human (GRCh38)
Location 7:22068473-22068495
Sequence TTTATGGGGGTGGATAGAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021571358_1021571369 18 Left 1021571358 7:22068432-22068454 CCTTGAGGGAAGGATAAGTTGAA No data
Right 1021571369 7:22068473-22068495 TTTATGGGGGTGGATAGAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021571369 Original CRISPR TTTATGGGGGTGGATAGAGG TGG Intergenic
No off target data available for this crispr