ID: 1021573866

View in Genome Browser
Species Human (GRCh38)
Location 7:22090454-22090476
Sequence CGGATCCCGGAGAAGCCGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021573866_1021573878 27 Left 1021573866 7:22090454-22090476 CCTGCCGGCTTCTCCGGGATCCG No data
Right 1021573878 7:22090504-22090526 GAGCAGCCAGCCGGTGCCACTGG No data
1021573866_1021573871 -8 Left 1021573866 7:22090454-22090476 CCTGCCGGCTTCTCCGGGATCCG No data
Right 1021573871 7:22090469-22090491 GGGATCCGTTGCGGGCTCAGTGG No data
1021573866_1021573877 18 Left 1021573866 7:22090454-22090476 CCTGCCGGCTTCTCCGGGATCCG No data
Right 1021573877 7:22090495-22090517 CCGAACTCAGAGCAGCCAGCCGG No data
1021573866_1021573872 -7 Left 1021573866 7:22090454-22090476 CCTGCCGGCTTCTCCGGGATCCG No data
Right 1021573872 7:22090470-22090492 GGATCCGTTGCGGGCTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021573866 Original CRISPR CGGATCCCGGAGAAGCCGGC AGG (reversed) Intergenic
No off target data available for this crispr