ID: 1021577091

View in Genome Browser
Species Human (GRCh38)
Location 7:22114772-22114794
Sequence CTGACTCCACAGTCCTACCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021577091_1021577097 -4 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577097 7:22114791-22114813 TCAGCAGTGGGCACAGGACAGGG No data
1021577091_1021577100 2 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577100 7:22114797-22114819 GTGGGCACAGGACAGGGAAGGGG No data
1021577091_1021577095 -10 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577095 7:22114785-22114807 GTGGAGTCAGCAGTGGGCACAGG No data
1021577091_1021577099 1 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577099 7:22114796-22114818 AGTGGGCACAGGACAGGGAAGGG No data
1021577091_1021577098 0 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577098 7:22114795-22114817 CAGTGGGCACAGGACAGGGAAGG No data
1021577091_1021577101 7 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577101 7:22114802-22114824 CACAGGACAGGGAAGGGGTGAGG No data
1021577091_1021577102 20 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577102 7:22114815-22114837 AGGGGTGAGGTGTTCCTTTCCGG No data
1021577091_1021577096 -5 Left 1021577091 7:22114772-22114794 CCCTGGTAGGACTGTGGAGTCAG No data
Right 1021577096 7:22114790-22114812 GTCAGCAGTGGGCACAGGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021577091 Original CRISPR CTGACTCCACAGTCCTACCA GGG (reversed) Intergenic
No off target data available for this crispr