ID: 1021577750

View in Genome Browser
Species Human (GRCh38)
Location 7:22119841-22119863
Sequence GAATATCCAGAGAGGGTGCA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 160}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021577745_1021577750 0 Left 1021577745 7:22119818-22119840 CCCTATTCTGAAGAGGCCTTGGT 0: 1
1: 0
2: 0
3: 7
4: 139
Right 1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG 0: 1
1: 0
2: 2
3: 18
4: 160
1021577746_1021577750 -1 Left 1021577746 7:22119819-22119841 CCTATTCTGAAGAGGCCTTGGTG 0: 1
1: 0
2: 0
3: 12
4: 135
Right 1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG 0: 1
1: 0
2: 2
3: 18
4: 160
1021577741_1021577750 22 Left 1021577741 7:22119796-22119818 CCACGCTTCTAGCCAGAACAAAC 0: 1
1: 0
2: 2
3: 5
4: 61
Right 1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG 0: 1
1: 0
2: 2
3: 18
4: 160
1021577742_1021577750 10 Left 1021577742 7:22119808-22119830 CCAGAACAAACCCTATTCTGAAG 0: 1
1: 0
2: 1
3: 7
4: 98
Right 1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG 0: 1
1: 0
2: 2
3: 18
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021577750 Original CRISPR GAATATCCAGAGAGGGTGCA TGG Exonic
900427747 1:2588165-2588187 GAGGGTCCACAGAGGGTGCAGGG - Intronic
901325552 1:8363180-8363202 GAATAAACAGAAAGGGTGTAGGG - Intronic
901913931 1:12483185-12483207 GAATAGCCAGAGCTGGTACACGG - Intronic
902688256 1:18092980-18093002 GAATATCCAGAGAAGAGGAAAGG - Intergenic
903227421 1:21901763-21901785 CAAAATCCAGAGACAGTGCAGGG + Intronic
905816465 1:40954774-40954796 GAATAACCAGCAAGGGTGTAGGG + Intergenic
906561337 1:46759798-46759820 GAATAAGCAGAGAGAGTGCAAGG - Intronic
909452912 1:75818728-75818750 GAATATACAGAGAAGGACCAGGG - Intronic
909530251 1:76673990-76674012 AAACCTCCTGAGAGGGTGCAGGG + Intergenic
912790625 1:112646135-112646157 GTATATCCAGAAAGGGAGAATGG + Intronic
914858869 1:151370711-151370733 GAATACCCAGAGGGGGTGGCAGG + Intronic
915296411 1:154924809-154924831 GAACATCCAGTCAGGATGCAAGG + Exonic
916392398 1:164344784-164344806 GAAGATAAAGAGAGGGTGGATGG - Intergenic
918463149 1:184796156-184796178 GGATAGCCAGAGAGGCTGAAAGG - Intronic
918579285 1:186106944-186106966 GAATATCTAGTGAGAGTGCATGG + Exonic
920281646 1:204847949-204847971 GGATATAAAGAGAGGGTGGAGGG + Intronic
920693066 1:208161420-208161442 GATTCTCCAGAGAGGCTGGAGGG - Intronic
921124735 1:212167344-212167366 GAATATCCACAGAGGGATGAAGG - Intergenic
922392382 1:225158328-225158350 GAAAATCCAGAGATGGGGCAGGG + Intronic
1065411707 10:25436547-25436569 GAGTGGCCAGAGAGGGTGGAAGG + Intronic
1065506277 10:26433157-26433179 TGATATCCAGAGATGTTGCAAGG - Intergenic
1070796126 10:79217457-79217479 CAATATCCAGACACGGTGCTAGG - Intronic
1072189597 10:93069023-93069045 GCCAATCCAGGGAGGGTGCATGG + Intergenic
1078275663 11:9843071-9843093 GGATAACCAGAGTGGGTTCAGGG - Intronic
1082686861 11:56248852-56248874 GGATTTCCAGAGAATGTGCATGG + Intergenic
1083306601 11:61764972-61764994 GCATATCCAATGAGGGTGCAGGG + Intronic
1083844408 11:65322405-65322427 GAATAACCACAAAGTGTGCAAGG + Exonic
1087269537 11:96097452-96097474 TAATATCCTGAGGGGCTGCAGGG + Intronic
1089154932 11:116394446-116394468 GAAAATGCAGAGAGGGGTCACGG - Intergenic
1090393349 11:126403674-126403696 GAAGATGGAGAGAGGGAGCAGGG + Intronic
1091463520 12:664043-664065 GATTAGCCATAGAGGGAGCAGGG + Intergenic
1092219242 12:6701328-6701350 GATAATCCAAAGATGGTGCAAGG - Intergenic
1096471157 12:51876816-51876838 GAATCTCCAGAGTGGGTTCCAGG + Intergenic
1100763488 12:97835622-97835644 TACTATGCAGAGAGGGGGCAGGG - Intergenic
1101311127 12:103580322-103580344 GAGGAACCAGAGAGGGTGCCAGG + Intergenic
1102578219 12:113870628-113870650 GAATGTCCACTGAGGTTGCAGGG + Intronic
1106343154 13:28850468-28850490 GAATCTAGAGAGAGGGTGCCTGG - Intronic
1107781978 13:43913137-43913159 GAACAGCCAGAGAGGGAGAAGGG + Intergenic
1113463283 13:110496464-110496486 GACTATCCTGGGAGGCTGCATGG + Intronic
1114731120 14:24993808-24993830 GACTATCAAGGGAGGGTCCAAGG - Intronic
1115161594 14:30402551-30402573 GAATATCAAGAGATGTTGCATGG + Intergenic
1116196042 14:41726439-41726461 GAATATCCTGGAAGGATGCATGG - Intronic
1118370793 14:65135684-65135706 GAATATGCAGAGAGGGTGCCAGG - Intergenic
1119933193 14:78567426-78567448 GAAGATCCAGAGATGGAGCAGGG - Intronic
1120344654 14:83270492-83270514 CAATATCAAGAGTGGATGCAGGG + Intergenic
1121285633 14:92733370-92733392 GAATATCCAGAAAGGGCTCTGGG + Intronic
1122700315 14:103583996-103584018 GCATGCCCAGAGAGGGCGCAGGG - Intronic
1123889129 15:24757752-24757774 GAACATGCAGAGATGGTGGAGGG + Intergenic
1124811451 15:32943195-32943217 AAATATCCACATAGGGTACACGG + Intronic
1127944630 15:63738572-63738594 GAAAATTCAGAGAGGGTCAAAGG + Intronic
1129931895 15:79418434-79418456 GGATAGGCAGAGTGGGTGCAGGG - Intronic
1132471383 16:105515-105537 GGATATTCACAGAGGGTCCATGG + Intronic
1133203780 16:4220607-4220629 GGATATCCAGAGAGGGAGCCAGG - Intronic
1140844907 16:78877536-78877558 GAAAAGGAAGAGAGGGTGCAAGG - Intronic
1141476659 16:84278587-84278609 GCATATCCAGGCAGGGGGCATGG - Intergenic
1141839402 16:86565292-86565314 GAACAGCCAGGAAGGGTGCAAGG + Intergenic
1142681971 17:1555273-1555295 GAATATCAAGAGAGATTGAAGGG - Intronic
1144650166 17:17002280-17002302 AAATATCCAGAGACTGTGCCGGG + Intergenic
1144828662 17:18120288-18120310 GAATGTCCAGAGAGGGTGGCAGG - Exonic
1146372608 17:32275002-32275024 CAAGATGCAGAGCGGGTGCATGG - Intronic
1148000097 17:44382829-44382851 GAGTGTCCAGAGAGGGAGGAGGG - Intronic
1148740564 17:49890288-49890310 GAAGATCCAGCGAAGGTGCTGGG - Intergenic
1149975164 17:61258146-61258168 GAATAATCAGAAAGGTTGCAAGG - Intronic
1153817024 18:8799336-8799358 GATTGTACAGAGAGGGAGCAGGG - Intronic
1155396641 18:25393297-25393319 GAATCTCCAGCCATGGTGCAGGG + Intergenic
1155396734 18:25393734-25393756 GAATCTCCAGCCATGGTGCAGGG + Intergenic
1155542661 18:26884326-26884348 TAATACCCAGAGAGGGAGAAGGG + Intergenic
1156818792 18:41344419-41344441 GAATGTCCAGAGAGTGTGTGGGG - Intergenic
1158928720 18:62299077-62299099 GAATATTGAGAGAAGGCGCAGGG - Intronic
1160284418 18:77527693-77527715 GAAGCTCCAGTAAGGGTGCAAGG - Intergenic
1160917462 19:1504055-1504077 GAGCAACCAGAGAGGGTGAAGGG - Intergenic
1162704410 19:12544632-12544654 GAATGCACAGAGAGGCTGCAGGG + Intronic
1165434449 19:35788459-35788481 CAAGATCCAGTGAGGGTGAAGGG - Exonic
1167442379 19:49515875-49515897 GTATATGCAGAGAGGGGGAAGGG - Intronic
1167800211 19:51735814-51735836 GGGTATCCAGGGAGGGTGAAGGG - Intergenic
925648945 2:6068360-6068382 GATTATGCACAGAGGGAGCAGGG - Intergenic
925681340 2:6425150-6425172 GACTATTCGGAGAGGGAGCATGG - Intergenic
927719980 2:25376409-25376431 GAAGAGCCAGAGAGGGGCCACGG + Intergenic
932630887 2:73342378-73342400 GATTAACCAGAGAGGTTGAAGGG + Intergenic
932781764 2:74563070-74563092 GAATGTCCAGAGAGGGTACAAGG + Intronic
938778528 2:134563075-134563097 GAATATCAGGAAAGGGTCCAGGG - Intronic
940890509 2:159031079-159031101 GATTATCCAGAGAGGGTCTCAGG + Intronic
942775349 2:179575031-179575053 GACCATCCAGAGAGGGTAGAGGG - Intronic
946098898 2:217301838-217301860 GAATAAGTAGAGAGGGTGTAAGG - Intronic
948320752 2:237066842-237066864 GAAACTTCAGAGAGGGTGGAAGG + Intergenic
948613868 2:239185665-239185687 GGATACCCAGAGAGGGTCCAAGG - Intronic
948680689 2:239632633-239632655 TAATTTCCAGAAAGGGTGCCTGG + Intergenic
948709323 2:239815838-239815860 TAACAACCAGAGAGGGCGCAGGG + Intergenic
1168760173 20:345180-345202 CAAGATTCAGAGAGGGTACAAGG + Intergenic
1170763915 20:19274346-19274368 GAATATCCAGAGAAGGTGGCTGG - Intronic
1171208832 20:23301600-23301622 GAACATCTGGAGAGGGAGCAGGG + Intergenic
1172468847 20:35176119-35176141 GACTGTGCAGAGAGGGTGCCAGG - Intronic
1174677291 20:52370664-52370686 GAATACCCAGAGCAGGTTCAGGG - Intergenic
1175461934 20:59158338-59158360 GCATTTCCAGAAAGGGTCCAGGG + Intergenic
1177129391 21:17238015-17238037 GAATAAACAGAGAGGTTGGAAGG + Intergenic
1177476090 21:21625581-21625603 TAATATCCACAAAGGGTGTAAGG - Intergenic
1177490490 21:21819412-21819434 GGATATACAGAAAGGCTGCAAGG + Intergenic
1177752002 21:25296287-25296309 GAATAACCATAGAATGTGCAAGG + Intergenic
1178013956 21:28320498-28320520 GAATATGGACAAAGGGTGCATGG - Intergenic
1179523495 21:41960486-41960508 GAGTCTGGAGAGAGGGTGCACGG + Intergenic
1179674855 21:42974495-42974517 CAATATTCAGAGAGGGGGCGGGG - Exonic
1180758919 22:18183890-18183912 CAATGTCCAGAGAGGCTGTAGGG - Intergenic
1180769206 22:18367681-18367703 CAATGTCCAGAGAGGCTGTAGGG - Intergenic
1180777106 22:18494714-18494736 CAATGTCCAGAGAGGCTGTAGGG + Intergenic
1181295770 22:21837422-21837444 GATCATCCAGAGAGTGTGTATGG + Intronic
1182852169 22:33484738-33484760 GAATAACCAGACCGGGGGCATGG - Intronic
1203277223 22_KI270734v1_random:96815-96837 CAATGTCCAGAGAGGCTGTAGGG - Intergenic
950456553 3:13096107-13096129 GAAGAGCCAGGGAGGGTGCTGGG - Intergenic
951858353 3:27223400-27223422 GGTTATCCAGAGAGGTTTCAGGG - Intronic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
954214931 3:49119403-49119425 GAATATCCTGAGAGTGTCCAGGG - Intronic
954452095 3:50577193-50577215 GTCTATCCAGAGTGGGTGGAGGG - Intronic
956719975 3:72109071-72109093 GAATCTCCAGAGATGGGACAAGG + Intergenic
956731289 3:72198906-72198928 AAATATCCAGGGAAGGTGCCAGG - Intergenic
960034349 3:113087300-113087322 GAAACTCCAGAGAGGTTGAAGGG + Intergenic
961597243 3:128028186-128028208 GAAAAACTAGAGAGGGGGCAGGG + Intergenic
965552929 3:169987819-169987841 GAATCTCCAGAGAGGGGTCTTGG + Intronic
966651069 3:182301683-182301705 AATTATCCAGAGATGTTGCAAGG - Intergenic
967332365 3:188303770-188303792 GAATCTCCAGGGAGGGTACTGGG - Intronic
973085187 4:46050052-46050074 GAAAATCCAGAGAAGATGCATGG + Intronic
975471201 4:74770485-74770507 GAATTTCCAGGGAGAGTGAATGG + Intronic
977295030 4:95200655-95200677 GAATATCAAGAGAGAGTAGAGGG - Intronic
978822578 4:112982641-112982663 GAAGATTCAGAGAGGATGGAGGG + Intronic
981894561 4:149782881-149782903 GAGTGTCCAGTGAGGGTGGAAGG - Intergenic
982508414 4:156249985-156250007 GAAGAGCCAGAGGTGGTGCAGGG - Intergenic
984771806 4:183443283-183443305 GAAAATCTAGAGGGGGTGGACGG - Intergenic
988262585 5:28907920-28907942 AAATAGCCAGAGAGGGTGGCAGG - Intergenic
992833066 5:80614418-80614440 GAATATGGAGAGATGGAGCAAGG - Intergenic
997825887 5:137106615-137106637 GGATTTGCAGAGAGGGTGCAGGG - Intronic
998578286 5:143341899-143341921 GAAAATACAGAGAGGGAGGAGGG + Intronic
998650844 5:144119505-144119527 GAAAGGCCAGAGAGGGTGAAGGG - Intergenic
999897072 5:156046219-156046241 GAATATCTATAGAAGATGCAAGG + Intronic
1000825476 5:166038687-166038709 GCAGTTCCAGAGATGGTGCAAGG + Intergenic
1002003996 5:176216947-176216969 GGATATCCAGAGAGAATGCGCGG + Intergenic
1002279408 5:178121881-178121903 GGAGATCCAGGGAGGGTACATGG + Exonic
1003772191 6:9318229-9318251 GAATACCCAGGGAGGGAGCCAGG - Intergenic
1007169157 6:39850271-39850293 GAAAATCAAGGAAGGGTGCAAGG - Intronic
1007360639 6:41353013-41353035 GAATCCTCAGAGAGGGTGCTGGG - Intergenic
1009049356 6:58259617-58259639 TAATATCCAGAGAGGGGAGAGGG - Intergenic
1010318834 6:74483202-74483224 GAATATGTAGAGAGGGAGGAAGG - Intergenic
1011079156 6:83470658-83470680 GAATATACAGAGAGAAAGCAAGG + Intergenic
1011814125 6:91168440-91168462 GAGTACCCAGAGAGGCTTCAGGG - Intergenic
1011898695 6:92264517-92264539 GAGAAGCCAGAGAGGGTGGAGGG - Intergenic
1012885026 6:104836032-104836054 GAGTTTCCTGAGAGTGTGCATGG - Intronic
1015330973 6:131978714-131978736 GAAGAGCCAGGAAGGGTGCAAGG + Intergenic
1018093868 6:160367866-160367888 GACTCAACAGAGAGGGTGCAGGG - Intronic
1019814402 7:3189157-3189179 GATCATCCAGGGAGGCTGCAGGG + Intergenic
1021577750 7:22119841-22119863 GAATATCCAGAGAGGGTGCATGG + Exonic
1023291048 7:38669460-38669482 GAATTTCCAGTGAGGATGGAGGG + Intergenic
1024281780 7:47724594-47724616 GAACAGCCTGGGAGGGTGCAGGG + Intronic
1025044650 7:55682568-55682590 GAACGTGCAGTGAGGGTGCAAGG - Intergenic
1027953532 7:84850796-84850818 GTTTATGCAGAGAGGGTACATGG + Intergenic
1030690567 7:112528386-112528408 GAGAATCAAGAGAGGGTACAGGG - Intergenic
1030829403 7:114202264-114202286 GAACATACAGAGAGGATGTAAGG - Intronic
1031619241 7:123916241-123916263 GAATATCCAGAAAGAGTTGAGGG + Intergenic
1032264351 7:130360446-130360468 GAATGTACACAGAGGGTGCAGGG + Intronic
1032802327 7:135326975-135326997 GAATATCCAGGTAGGGTCCCTGG + Intergenic
1033094783 7:138420895-138420917 AAATATCCAGACAGTGTTCAAGG + Intergenic
1033271573 7:139937285-139937307 GAACATCCAGACAGGGTGGATGG - Intronic
1035612918 8:980249-980271 AAATATCCATAGAAGGTGCAGGG + Intergenic
1037294105 8:17382922-17382944 GAGAATGCAGTGAGGGTGCAGGG + Intronic
1038475312 8:27862170-27862192 GGGTATCCTGAGGGGGTGCAGGG + Intergenic
1038563190 8:28598140-28598162 GAAAATCCAGGCCGGGTGCAGGG - Intergenic
1039493099 8:37962464-37962486 GAATATCCAGAGATGGGGAGAGG + Intergenic
1045419050 8:101995917-101995939 GAATATCTATAGAGTTTGCAGGG - Intronic
1045788200 8:105950012-105950034 GAATATCAACAGAGGGTTCAAGG - Intergenic
1045933588 8:107654459-107654481 GCAGATTCAGAGAGGCTGCAGGG + Intergenic
1048854810 8:138677323-138677345 GATTATGCAGAGAGAGTGCTTGG + Intronic
1049883390 9:12926-12948 GAATATCAAGAGGGAGTGGAGGG - Intergenic
1054874150 9:70077718-70077740 GAACATCCAAAGAGGAAGCAAGG - Intronic
1057065730 9:92049127-92049149 GAATATCCCGGGAGGTTGGATGG - Intronic
1059733738 9:117081477-117081499 GAGTATACAGACAGTGTGCAGGG - Intronic
1060301491 9:122376998-122377020 AAATCTCCTGGGAGGGTGCATGG - Intronic
1061176185 9:128998782-128998804 GGATATCCTGAGATGGAGCAGGG + Intronic
1062606465 9:137350846-137350868 GCATCTCCAGGGAGGGAGCAGGG - Intronic
1188766033 X:34092276-34092298 GAAAAGACAGAGTGGGTGCATGG + Intergenic
1195866094 X:109434494-109434516 GAATTTCCAGATAAGGTGCCCGG - Intronic
1197765063 X:130054940-130054962 GAAGATCCAGTGAGGGTGGGTGG + Intronic
1200061299 X:153484971-153484993 GAACATGGAGAGAGGGAGCAGGG - Intronic
1200402425 X:156027222-156027244 GAATATCAAGAGGGTGTGGAGGG + Intergenic
1201190992 Y:11441452-11441474 GAAGATCCAGAGAAGGAGCAGGG - Intergenic