ID: 1021579501

View in Genome Browser
Species Human (GRCh38)
Location 7:22138158-22138180
Sequence TGCCACTGGGACATTTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 182}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021579501 Original CRISPR TGCCACTGGGACATTTGTGA GGG (reversed) Intronic
901683669 1:10931297-10931319 TGGCACCAGGACATTCGTGAGGG - Intergenic
903177531 1:21589962-21589984 TCCAACTGGGACATTCCTGAAGG + Intergenic
903788068 1:25874732-25874754 TGCTACAGGGAAATTTCTGAAGG + Intergenic
903804117 1:25991964-25991986 TGCCACTGGGTAACTTGGGAAGG - Intronic
906247973 1:44290378-44290400 TGCCACAGGGACACCTGTGAGGG + Intronic
907757023 1:57320294-57320316 TGCAACTGGGTAATTTATGAAGG - Intronic
908980339 1:69949166-69949188 TGGGACTGGGAGATTGGTGAGGG - Intronic
910054780 1:83020299-83020321 TGCCATAGTGACATTTATGATGG - Intergenic
910166191 1:84329793-84329815 TGACACTGGGTTATTTGTGATGG - Intronic
910475528 1:87602221-87602243 TTCTACTGGGACATTTGAAATGG + Intergenic
911554267 1:99324261-99324283 TGCCACTGATACATGGGTGAGGG - Intergenic
915584746 1:156838293-156838315 GGCCACAGGGACAGTTTTGAGGG + Intronic
916974129 1:170056441-170056463 TGCCACTTGGCCATTTTAGAAGG + Intronic
917228991 1:172815262-172815284 TGAGACTGGGAAATTTGTAAAGG + Intergenic
919323532 1:196075044-196075066 TACCAATATGACATTTGTGAAGG - Intergenic
921485400 1:215709678-215709700 TCCCACTGGGAAATTAGTCAAGG - Intronic
922042557 1:221910968-221910990 TCCCACAGGGACCTTGGTGATGG - Intergenic
922172195 1:223165291-223165313 TGCCACTGGGAATTTAGGGAGGG - Intergenic
922189728 1:223307594-223307616 TGCCACTGGGACTTTTGCGGGGG + Intronic
1063326078 10:5103581-5103603 TGTCAATGGGACATTTGTCTGGG + Intronic
1065497108 10:26340686-26340708 TGGCACTGGAGAATTTGTGAGGG - Intergenic
1066417314 10:35233236-35233258 TGCAACTGGGAAATTTCTGAAGG - Intergenic
1069577671 10:69542507-69542529 TGACACTGGGTAATTTATGAAGG + Intergenic
1072626495 10:97115650-97115672 TGTCACTGGGTCATTGCTGAGGG + Intronic
1073926589 10:108523004-108523026 TGCCACTGGGAAAATTGTGCTGG - Intergenic
1073961202 10:108931257-108931279 TGAGACTGGGTAATTTGTGAAGG + Intergenic
1073994560 10:109300846-109300868 GGCCAGTGGGAAATTTGTGGGGG - Intergenic
1074465414 10:113677588-113677610 TGCCACTAGCAAATCTGTGACGG + Intergenic
1075864003 10:125702339-125702361 TGCCTTTGGGACATCTGAGAGGG - Intergenic
1076090593 10:127682175-127682197 TGCCCATGGGTCTTTTGTGAAGG - Intergenic
1076746227 10:132516043-132516065 AGCCACTGGGAAAGTGGTGAGGG + Intergenic
1079175213 11:18133744-18133766 TGAGACTGGGAAATTTATGAAGG - Intronic
1081788191 11:45763331-45763353 TGGCACTGGGCCATTTATGAGGG - Intergenic
1083326929 11:61877678-61877700 TGCCCCTGGGACGTTGGTGCTGG + Intronic
1083675115 11:64320882-64320904 TCCCACTGGGGCCTTTGGGAAGG + Exonic
1084459109 11:69286397-69286419 TGTCACTGGCCCATTTCTGAAGG - Intergenic
1089972532 11:122705648-122705670 AGCCACAAGCACATTTGTGACGG - Intronic
1090543334 11:127733427-127733449 TCCCACTGGTGCATTTGGGAAGG + Intergenic
1090550342 11:127812617-127812639 TACCACTGAGACATTGGGGATGG + Intergenic
1093127287 12:15345807-15345829 TGCCTCTCTGACATTTGTAAAGG - Intronic
1095279682 12:40335557-40335579 TGCCTCTGAGACATGTGAGATGG - Intronic
1097225203 12:57473009-57473031 TCCCATTGGGACATTGCTGATGG - Intronic
1099440682 12:82695874-82695896 TTCCTCTGGGACATTTCTCATGG + Intronic
1099738940 12:86605912-86605934 TGACACTGGGTAATTTGTAAAGG + Intronic
1100216430 12:92454751-92454773 TGTCACTGGGAAGTCTGTGATGG + Intergenic
1106468083 13:30030720-30030742 TGAGACTGGGTCATTTATGAAGG + Intergenic
1106585544 13:31053594-31053616 TGCCTGTGGGGCATCTGTGAGGG - Intergenic
1109601471 13:64635535-64635557 TGTCATTGGCACATTTATGAGGG - Intergenic
1110521987 13:76490615-76490637 TGAGACTGGGTCATTTATGAAGG - Intergenic
1111053619 13:82919272-82919294 TGCCACTCTGACTTTTGTCACGG + Intergenic
1116805142 14:49486978-49487000 TGCTACAGGGACACTTGTGCAGG - Intergenic
1119618515 14:76114212-76114234 GGCCACTGGGCCATCTGTGATGG - Intergenic
1120284914 14:82487603-82487625 AGCCACTGGAATATTTGTCAAGG + Intergenic
1120760295 14:88278902-88278924 TGCCATTGGGAGATTTTTAATGG + Intronic
1121595667 14:95159997-95160019 TGACACTAGGACAGGTGTGAGGG - Intergenic
1122445141 14:101762151-101762173 GGCCGCTGGGACCTTCGTGATGG + Intronic
1123021296 14:105398988-105399010 TGCCCCTGGAACGTTTGAGAAGG + Intronic
1124127452 15:26949433-26949455 CACCACTGAGAAATTTGTGATGG - Intergenic
1124641067 15:31397115-31397137 TGCCACAGGAACATTTGCCAGGG + Intronic
1125383526 15:39112797-39112819 TGAGACTGGGTAATTTGTGAAGG - Intergenic
1125510211 15:40288684-40288706 TCCCACTGGGACATTTAGCAAGG - Exonic
1126872673 15:53006676-53006698 TGCCTCTGGAACTTTTGTGAAGG + Intergenic
1127319006 15:57824545-57824567 TGTCACTGGAACACTTCTGAAGG + Intergenic
1129223851 15:74153937-74153959 AGCCACAGAGACATTTTTGAAGG - Intergenic
1130667813 15:85884713-85884735 TGCCACTGGACCATTTCTGCAGG + Intergenic
1131464250 15:92642725-92642747 TGAGACTGGGAAATTTATGAAGG - Intronic
1131491535 15:92867517-92867539 TGAGACTGGGAGAGTTGTGAAGG + Intergenic
1131838897 15:96416234-96416256 AGACACGGGGACATTTGTCATGG - Intergenic
1132867204 16:2099263-2099285 GGCCACTGGGACGTTTCTAAGGG + Intronic
1132869356 16:2108871-2108893 TACCACTGGGACTTTGGGGATGG - Exonic
1133921064 16:10153769-10153791 TGCCACTTGGACAACTGAGACGG + Intronic
1134718056 16:16366727-16366749 TACCACTGGGACTTTGGGGATGG + Intergenic
1134956696 16:18385432-18385454 TACCACTGGGACTTTGGGGATGG - Intergenic
1135125725 16:19807782-19807804 TGTCACAGGGTCATATGTGAGGG + Intronic
1140189668 16:72804694-72804716 TCCCACTCTGACATTTGGGAGGG + Intronic
1141058643 16:80843087-80843109 TGCCTGTGGGTCATTTGGGAGGG - Intergenic
1141148939 16:81551100-81551122 TGGAACTGGGATATATGTGATGG - Intronic
1141148950 16:81551160-81551182 TAGAACTGGGACATATGTGATGG - Intronic
1147725379 17:42563428-42563450 AACCACTGTGACATTTGGGAAGG - Intronic
1151406290 17:73889033-73889055 GGGCACTGTGCCATTTGTGAAGG - Intergenic
1151902405 17:77025308-77025330 TGACACTGGGTAATTTATGAAGG + Intergenic
1151995494 17:77606181-77606203 TGCCCCTGGGAGCATTGTGAGGG + Intergenic
1153684465 18:7531633-7531655 TTCCACTGGGTCTTTTGGGAAGG + Intergenic
1154927824 18:20955974-20955996 TAGCACAGGGACACTTGTGATGG + Intronic
1155240705 18:23861449-23861471 TGCCACTGGGAGTTCTGGGAAGG - Intronic
1159497655 18:69226467-69226489 AGCCACTGGAAGATTGGTGATGG + Intergenic
1162155382 19:8674357-8674379 TGAGACTGGGAGATTTGTGAAGG + Intergenic
1162326113 19:10000635-10000657 TGCCACTTGAGCACTTGTGAAGG - Intronic
1163323483 19:16588089-16588111 TGCCATTTGGCCCTTTGTGAAGG + Intronic
1164143172 19:22492601-22492623 TGCCAATGAGACCTCTGTGAAGG - Intronic
1164914105 19:32036710-32036732 TGCCACAGGGAGAATTATGATGG - Intergenic
928923804 2:36555348-36555370 TGGCACTGGGAAATTTGAGAAGG - Intronic
929482920 2:42328733-42328755 AGCCACTGAGAAATTTGTAAAGG + Intronic
930002798 2:46872356-46872378 TGGCACTTGGACAATTGTCATGG - Intergenic
930236726 2:48895653-48895675 TGCCACTGGGACACATATGTGGG - Intergenic
933982962 2:87568554-87568576 TGCAACTGGGTAATTTATGAAGG + Intergenic
934968407 2:98743215-98743237 GGCCACATGGCCATTTGTGAAGG + Intergenic
935686528 2:105688779-105688801 TTCCACTGGTACATTTAAGACGG + Intergenic
936310879 2:111382241-111382263 TGCAACTGGGTAATTTATGAAGG - Intergenic
937157671 2:119732513-119732535 GGCCACTGAGACATTTGGGCAGG - Intergenic
938250563 2:129812785-129812807 TCCCACTGGGACAATGGGGAGGG - Intergenic
939511187 2:143107308-143107330 TATAACTGAGACATTTGTGAAGG - Intronic
940491400 2:154366189-154366211 TGCATCTGGGACATTTTTTAGGG - Intronic
944100805 2:196024209-196024231 TGCCAGTAGGAGGTTTGTGAGGG - Intronic
946512293 2:220371439-220371461 TGGCACTGAAACATTTTTGAAGG + Intergenic
947744571 2:232500908-232500930 GGCCACTGGGACATCTGGGAAGG + Intergenic
947744628 2:232501233-232501255 TGCCCCTGGCACATCTGTGGTGG + Intergenic
947870649 2:233436010-233436032 TGCCACTGTTTCATTTGAGATGG + Intronic
948308004 2:236963960-236963982 TGCCTCTGGGACATGTGGGATGG + Intergenic
948408929 2:237743931-237743953 TGCCCTTGGGACATTCCTGATGG - Intronic
1169508251 20:6236364-6236386 TGCCCCTGAGACATATGTGCTGG - Intergenic
1169996365 20:11561708-11561730 TGCAATTGGGAAACTTGTGATGG + Intergenic
1173094456 20:40011784-40011806 TGCCAATGGGAGGTTTATGATGG - Intergenic
1174043166 20:47714416-47714438 AGCTGCTGGGACATATGTGAGGG - Intronic
1177765370 21:25451166-25451188 TGAAACTGGGAAATTTATGAAGG + Intergenic
1178511075 21:33205615-33205637 TGGCATTGGGAAATGTGTGAAGG + Intergenic
1179581473 21:42347256-42347278 TGCCACTGCGTCATCTGTGATGG - Intronic
1179787728 21:43739434-43739456 TGAGACTGGGTCATTTGTAAAGG + Intronic
1184422721 22:44391274-44391296 TGCCACTGGGAGCTGTGTGAGGG - Intergenic
949655527 3:6214015-6214037 TTCCACTGGAACAATTGTGTGGG + Intergenic
952559795 3:34578095-34578117 TGAAACTGGGAGATTAGTGAAGG - Intergenic
954165452 3:48753742-48753764 TGGCACTGGGATATTGGGGATGG - Intronic
954763430 3:52894296-52894318 TGACACTGGGACATGTGTGTGGG + Intronic
961572300 3:127808428-127808450 TTCCCCTGGGACTTTTGGGAAGG - Intronic
963975076 3:151471269-151471291 TGAGACTGGGCCATTTATGAAGG - Intergenic
966617651 3:181929314-181929336 TGCCACTGGAACACTTGGCAGGG - Intergenic
967419950 3:189261734-189261756 TGCTACTGGGAGATATGGGAAGG + Intronic
968032982 3:195518978-195519000 TGTCACTGAGACTTTTGTAATGG - Intronic
968487036 4:867747-867769 TGCCATGGGGACATTGGTGCTGG - Intronic
969690558 4:8701857-8701879 TGCCCCTGGAAGGTTTGTGAGGG - Intergenic
970209926 4:13698534-13698556 TGACACTGGGACCTATCTGAGGG - Intergenic
970744833 4:19281898-19281920 TGAGACTGGGTAATTTGTGAAGG + Intergenic
970933129 4:21536988-21537010 TGCCACTGGTAAATGTTTGAGGG - Intronic
973154138 4:46927843-46927865 TGCCACTGGGAAATTTAGGGTGG + Exonic
973249852 4:48049436-48049458 TTCAACTGTAACATTTGTGAGGG - Intergenic
975082833 4:70300990-70301012 TGCCACTAGGGCAGTGGTGATGG - Intergenic
978104728 4:104887850-104887872 AGCCACTGGGAAATTTGTATAGG - Intergenic
978784402 4:112593478-112593500 TGCCACTGGGAAATCACTGAAGG - Intronic
980434336 4:132749017-132749039 ACCCACTGGCACATTTGTGGGGG - Intergenic
982314986 4:154023111-154023133 TGCCACAGGAACATCTGTGATGG + Intergenic
986364043 5:7011795-7011817 TGACACTGGGTGATTTTTGAAGG + Intergenic
986394748 5:7317416-7317438 TCCCAATGGGACATTTGGGAAGG + Intergenic
987285415 5:16451280-16451302 TGGCACTGGGACCTATGTAAGGG - Intergenic
989609090 5:43274257-43274279 TGCTAAAGGGACATTTGTGATGG + Intronic
989834203 5:45964109-45964131 TGGCAAAGGGACATTTGGGAGGG + Intergenic
990286089 5:54302090-54302112 TCCCACTGGGAAAGTTGTGTGGG - Intronic
993418364 5:87665729-87665751 TGCCACTGGGAAATTTCAAACGG - Intergenic
993884464 5:93399665-93399687 TACGACTGGGAAATTTCTGAGGG + Intergenic
995752648 5:115470303-115470325 TGCCACCTGGACATTTGGCAGGG + Intergenic
997161220 5:131611146-131611168 TGCTCATGTGACATTTGTGAAGG - Intronic
1001996070 5:176159766-176159788 TGCCACTTGGAAAGATGTGATGG - Intergenic
1003990945 6:11486008-11486030 GGCCGCTGGGAAATTTATGAGGG - Intergenic
1005939030 6:30547111-30547133 TGTGCCTGGGACATCTGTGAAGG - Exonic
1006091763 6:31632539-31632561 GGCCACTGTGACTGTTGTGAGGG - Exonic
1006274683 6:32993761-32993783 AGACACTGGGACCTTTGTGAAGG + Intergenic
1012144287 6:95662110-95662132 GGACACTGGGACCTTTTTGAGGG + Intergenic
1014269389 6:119319825-119319847 AGCCAATGGGACTTTTGTCAAGG + Intronic
1016533607 6:145086442-145086464 TGGCACTGAGCCATTTGTGAGGG + Intergenic
1016617962 6:146074775-146074797 TGCCTGTGGGATATTTGTGTCGG - Intronic
1017093962 6:150787667-150787689 TTCCACAGGGTCATTTCTGATGG + Intronic
1017357313 6:153524729-153524751 TGAGACTGGGACATTTATAAAGG + Intergenic
1017558407 6:155599785-155599807 TGTCACTGGGACAATAGGGAAGG - Intergenic
1017658560 6:156652486-156652508 TGTAACTGGGACCTTTGTCAGGG - Intergenic
1017957368 6:159189784-159189806 TTCCCCTGGGAATTTTGTGATGG + Intronic
1019062027 6:169263489-169263511 AACCACAGGGACATCTGTGACGG + Intergenic
1019629766 7:2042614-2042636 TGGCTCTGGGCCATTCGTGAGGG - Intronic
1021579501 7:22138158-22138180 TGCCACTGGGACATTTGTGAGGG - Intronic
1023668270 7:42548478-42548500 GGCCACTGAGCCATTTGTGAGGG - Intergenic
1023727604 7:43160501-43160523 TGCCTCTAGGACATTTATGGAGG - Intronic
1027990115 7:85347741-85347763 TGCCAAAGGGACAGTTGAGAAGG - Intergenic
1028754857 7:94423175-94423197 TGCCACTTGAAGATTTGTGTAGG - Intronic
1030097740 7:105915984-105916006 TGCCACTGCCAAATTTGAGAAGG + Intronic
1031611301 7:123831115-123831137 TGCCACTAAGCCCTTTGTGAGGG - Intronic
1034013986 7:147562065-147562087 TGCCACTGGGACATTTATCTGGG + Intronic
1036562501 8:9908443-9908465 GGATGCTGGGACATTTGTGATGG + Intergenic
1036937321 8:13015695-13015717 TTCCACTGAGACACTGGTGAAGG + Intronic
1036944356 8:13080742-13080764 CGCCACAGAGATATTTGTGAAGG - Intergenic
1038157822 8:25007503-25007525 AGCCACTGGGGCCTGTGTGAAGG + Intergenic
1038472945 8:27840297-27840319 TGCCTCTGGACCATTCGTGATGG - Intergenic
1038600972 8:28942048-28942070 TGCTACTGGGTCCTCTGTGAGGG + Intronic
1042959818 8:74291721-74291743 TGCCACAGTGACATTTGCGTTGG - Intronic
1044444107 8:92253743-92253765 TGACACTGGGGCTTTTCTGAGGG + Intergenic
1047525256 8:125627490-125627512 AGTCACTGTGACCTTTGTGATGG + Intergenic
1047735405 8:127760879-127760901 TGCCAGTGGCACAGTTTTGAGGG + Intergenic
1047796108 8:128257583-128257605 TTCAACTGGGACAATTCTGAAGG - Intergenic
1047952055 8:129943260-129943282 TTTCCCTGGGACAATTGTGAAGG + Intronic
1048818726 8:138359451-138359473 TGACAATGGTGCATTTGTGAAGG - Intronic
1048849775 8:138633863-138633885 TGCCATGTGCACATTTGTGAAGG - Intronic
1049181874 8:141227052-141227074 TGCCACTGGGACGGCTCTGACGG + Intronic
1050000548 9:1072795-1072817 TCCCAGTGGGAAAATTGTGAGGG + Intergenic
1050308954 9:4333679-4333701 TTCCAATGGGATTTTTGTGAAGG + Intronic
1053070701 9:35100131-35100153 TGGCACTGGGGCTTTGGTGAGGG + Exonic
1054821647 9:69527466-69527488 TCCCACTGGGACTGTTGTGAGGG - Intronic
1057557977 9:96102737-96102759 TGCCACTAAGCCATTTGTAAGGG + Intergenic
1061394589 9:130337123-130337145 TGTCACTGGGCCATATGTGCTGG - Intronic
1061645103 9:131994796-131994818 GGCCACTGGGACTACTGTGATGG - Intronic
1186586710 X:10882636-10882658 TGCAACTCTGACATCTGTGAGGG - Intergenic
1188557409 X:31428209-31428231 TGGCACTGAGCCATTCGTGAGGG - Intronic
1193058046 X:77175600-77175622 TGCCTCTGGGGCATTTTTGCAGG - Intergenic
1193414045 X:81200453-81200475 TATCACTGGGACATTTGAGTTGG - Intronic
1193789428 X:85800409-85800431 TGCCAGAGGGACATTTCTGCAGG - Intergenic
1194399450 X:93424849-93424871 AGCCACTGTAATATTTGTGAAGG - Intergenic
1195847343 X:109242334-109242356 TGCCACTGTTACATCTGTAAGGG - Intergenic
1198535395 X:137580694-137580716 TGACTCTGGGACATTACTGAGGG - Intergenic
1198829514 X:140734148-140734170 TTCCACGGGGAAATTTGGGACGG - Intergenic
1201351986 Y:13054089-13054111 TACTACTGGGACATCTCTGAAGG + Intergenic