ID: 1021586711

View in Genome Browser
Species Human (GRCh38)
Location 7:22216384-22216406
Sequence GGAATGGAGAGGGGTGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1127
Summary {0: 1, 1: 1, 2: 8, 3: 111, 4: 1006}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1021586711_1021586725 18 Left 1021586711 7:22216384-22216406 CCCAGCCCACCCCTCTCCATTCC 0: 1
1: 1
2: 8
3: 111
4: 1006
Right 1021586725 7:22216425-22216447 GCAGTCATGTATCTTCCCATGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1021586711_1021586724 17 Left 1021586711 7:22216384-22216406 CCCAGCCCACCCCTCTCCATTCC 0: 1
1: 1
2: 8
3: 111
4: 1006
Right 1021586724 7:22216424-22216446 TGCAGTCATGTATCTTCCCATGG No data
1021586711_1021586719 -8 Left 1021586711 7:22216384-22216406 CCCAGCCCACCCCTCTCCATTCC 0: 1
1: 1
2: 8
3: 111
4: 1006
Right 1021586719 7:22216399-22216421 TCCATTCCCTAGGAATCACCAGG 0: 1
1: 1
2: 0
3: 11
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1021586711 Original CRISPR GGAATGGAGAGGGGTGGGCT GGG (reversed) Intronic
900178532 1:1301553-1301575 GGAGTGGAGGGGGGTGGGGCTGG - Intronic
900239047 1:1605999-1606021 GGACTGGTCAGGCGTGGGCTGGG + Intergenic
900364606 1:2305957-2305979 GTCATGGTGAGGGGTGTGCTGGG + Intronic
900643963 1:3700438-3700460 GGAAGCGAGAGGAGTGGACTAGG + Intronic
900666260 1:3817517-3817539 GGACAGGAGTGGGCTGGGCTGGG - Intronic
900736609 1:4303231-4303253 GGAGTGGGGTGGGGTGGGGTGGG - Intergenic
900736612 1:4303236-4303258 GGAATGGAGTGGGGTGGGGTGGG - Intergenic
900736615 1:4303241-4303263 GGAATGGAATGGAGTGGGGTGGG - Intergenic
901403939 1:9033527-9033549 TGAAAGGTGAGAGGTGGGCTGGG - Intergenic
901414486 1:9107185-9107207 GGAGAGGAGGTGGGTGGGCTGGG - Intronic
901639373 1:10685747-10685769 GGAGTGGACAGGGGGAGGCTGGG - Intronic
901659880 1:10792363-10792385 GAAATGTGGAGGGGTGGGGTTGG + Intronic
901800464 1:11705254-11705276 GCAATGGAGAGGGGTGCGTGGGG + Intronic
901886719 1:12228841-12228863 GGAGTGCAGAGGGGTGATCTCGG + Intergenic
901895482 1:12308194-12308216 GGAGTGGAGGCGGGTGGGCAGGG + Intronic
901897862 1:12330006-12330028 GGAAAGGGCAGGGGTGGGGTGGG + Intronic
902044354 1:13513786-13513808 GGGATGGAGAGGGGAGGGGCGGG + Exonic
902259892 1:15216882-15216904 GGATTGGAGAGGGGTAGGAAAGG + Intronic
902286833 1:15412593-15412615 GGAAAGGAGAGACGGGGGCTGGG - Intronic
902347815 1:15831717-15831739 GAAATGGTGTGGGCTGGGCTGGG - Intergenic
902413295 1:16224843-16224865 GGACTGGAGTGGGGAGAGCTGGG + Intergenic
902561052 1:17277720-17277742 GGCATGGGGAGGGCTGGGGTTGG + Intronic
902564971 1:17305500-17305522 GGAAGGGCGGGGGGTGGGCATGG - Intergenic
902624086 1:17666792-17666814 GGGAGGGGGTGGGGTGGGCTTGG - Intronic
902624111 1:17666857-17666879 GAGATGGGGTGGGGTGGGCTGGG - Intronic
902726227 1:18337964-18337986 TGAATGGTGAGGGGAGGGCCGGG + Intronic
902746819 1:18480155-18480177 GAAATGGTGAGGGGGGGTCTGGG + Intergenic
903658124 1:24961150-24961172 GAAACTGAGAGGGGAGGGCTGGG + Intronic
903792617 1:25905630-25905652 GGGAAGGGGAGGGGTGGGCGGGG + Intronic
903888102 1:26552865-26552887 GGAATAGAGGGGGCTGGGGTGGG - Intronic
904043286 1:27596271-27596293 TGAAGGCAGATGGGTGGGCTTGG - Intronic
904076963 1:27850455-27850477 GTCATGGAGAAGGGTGGGATTGG + Exonic
904129190 1:28263008-28263030 GGAATGGAGGAGGGTGTGCAAGG - Intronic
904426087 1:30424125-30424147 TGGATGGAGAGGGGAGGCCTGGG - Intergenic
904614103 1:31740596-31740618 GGACTGGAGTGGGATGGGCCAGG - Intronic
904875560 1:33652001-33652023 GGAATGCAGAGGGCAGGGCAAGG + Intronic
905038274 1:34930724-34930746 GGGATGGTGAGGTGTGGGCTTGG + Intergenic
905205229 1:36339538-36339560 GGGATGGAGAGGGATGGGGCTGG + Intergenic
905361812 1:37426078-37426100 GGAAGTCAGAGGGTTGGGCTGGG - Intergenic
905868819 1:41391480-41391502 GGGACTGTGAGGGGTGGGCTTGG - Intergenic
906011946 1:42535562-42535584 ACAATGGAGAGGGGTCGGCCGGG + Intronic
906724900 1:48037098-48037120 GGAAAGGGGAGGGGAGGGTTGGG - Intergenic
907360007 1:53906705-53906727 GGAGTGCAGAGGGGTGACCTTGG + Intronic
907702347 1:56801430-56801452 GTAATAGAGAGGAGTGAGCTGGG - Intronic
907767117 1:57423210-57423232 AGAAGGAAGAGGGGCGGGCTGGG + Intronic
907772258 1:57477362-57477384 AGAATGGGGTGGGGTGGGATAGG - Intronic
907775143 1:57506898-57506920 GGAATGGAGAGGAGAGGGAATGG - Intronic
908344697 1:63219986-63220008 GTGATTGAGAGGGCTGGGCTTGG - Intergenic
908994834 1:70139083-70139105 GGATTGGAGACTTGTGGGCTTGG - Intronic
909472253 1:76041548-76041570 GGAGTTGATAGGGGTGGGGTTGG + Intergenic
910857126 1:91707129-91707151 GGAAAGGAGAGGTTTGGACTGGG - Intronic
911096940 1:94062504-94062526 GGAGTGGGCTGGGGTGGGCTGGG - Intronic
912323735 1:108738541-108738563 TGAATGGGGAGGGGTGGGGTGGG - Intronic
912480649 1:109979978-109980000 GGAATGGAGGGAGGTGGTTTCGG - Intergenic
912806011 1:112757781-112757803 GTGATGGAGAGGGTAGGGCTGGG + Intergenic
913324873 1:117618584-117618606 GGAATGTAGAGAGGAGGGGTGGG + Intronic
914676193 1:149909170-149909192 GGTGAGGAGATGGGTGGGCTGGG - Exonic
914767634 1:150653509-150653531 GGAATGGAGTGGTGTGATCTTGG + Intronic
915440914 1:155944998-155945020 AGGATGGAGAAGGGAGGGCTGGG + Intergenic
915474244 1:156143716-156143738 AGAATGGAGACGACTGGGCTAGG - Intergenic
915529357 1:156494476-156494498 TGGATGGGGAGGGGAGGGCTGGG + Intronic
915593134 1:156881763-156881785 GGAAGGGACAGGTGGGGGCTGGG + Intronic
915646889 1:157278965-157278987 CGAATGGAGCGTGGTGGGCGGGG + Intergenic
915720967 1:157985364-157985386 GGAGTGGAGAGCAGTGGGGTTGG + Intergenic
915749045 1:158187457-158187479 GGAATGCAGTGGCGTGGTCTCGG + Intergenic
915839734 1:159204547-159204569 GGAAGGAAGAGAGGGGGGCTGGG - Intronic
916025023 1:160825966-160825988 TGCATGGAGTGGGGTGGGGTTGG - Intronic
916438320 1:164797386-164797408 AGGATGGAGAGTGGAGGGCTAGG - Intronic
916749747 1:167713671-167713693 GGAGTGCAGAGTGGCGGGCTGGG + Intergenic
917562938 1:176178847-176178869 GGGATGGAGTGGGGTGGGGACGG - Intronic
918107597 1:181427326-181427348 GGAATTGAGATGGGAGGGGTTGG - Intronic
918543545 1:185657626-185657648 GGAGAGGAGAGGGGTGGGGAGGG - Intergenic
918733100 1:188022948-188022970 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
919773357 1:201177123-201177145 GGAATGGAGAGGGGTGTGGACGG - Intergenic
919781212 1:201222476-201222498 TGCAGGGAGAGGGGTGGACTAGG - Intronic
919792528 1:201301188-201301210 GGAATGGAGAGGGAAGGCCAGGG + Intronic
919896293 1:202011574-202011596 GGAATGGGGCTGTGTGGGCTGGG + Intronic
919920722 1:202164980-202165002 TGAATGGAGACGTTTGGGCTGGG + Intergenic
920129078 1:203717145-203717167 GGAATGCAGAGGCGTGATCTTGG - Intronic
920887940 1:209951270-209951292 GGAATGGAGAGGGGCAGGATAGG - Intronic
920950133 1:210564806-210564828 GGAATGGGGAGGGGAGGGGAGGG + Intronic
921338569 1:214111871-214111893 GGCATGGGGAGGGCTGGGCAGGG - Intergenic
921346916 1:214195786-214195808 GAAAGGGAGAGGGGTGAGCAAGG - Intergenic
922320609 1:224483103-224483125 GGAATGGGGAGGGATGGTGTTGG + Intronic
922702936 1:227772345-227772367 GGAAGGCAGAGTGGTGGGCGGGG - Intronic
923228706 1:231963519-231963541 GTGAGGGTGAGGGGTGGGCTGGG - Intronic
923679238 1:236105804-236105826 GGAATGCAGAGGCGTGATCTTGG + Intergenic
923854743 1:237834173-237834195 GGAAATGACAGGGGTGGGCCAGG - Intergenic
924454330 1:244206504-244206526 TGGATGGAGAGGGGTGGAGTGGG - Intergenic
924456036 1:244219595-244219617 GGAGTGGGCAGGGATGGGCTAGG + Intergenic
1062988393 10:1791215-1791237 GGAATAGACAGGGGTGCGCCAGG + Intergenic
1063529922 10:6821089-6821111 GGAGTGCAGAGGGGTGATCTCGG - Intergenic
1064930622 10:20621712-20621734 GAAATGTAGAGGGTAGGGCTGGG - Intergenic
1065301878 10:24330247-24330269 GGAGTGCAGTGGTGTGGGCTTGG - Intronic
1066278071 10:33888076-33888098 GGAATGGAGAGGGAGTGGGTGGG + Intergenic
1066459881 10:35603749-35603771 AGAAGGGAGATGGGTGGGCATGG + Intergenic
1066563124 10:36691815-36691837 GGAATGGACAGGTCTGGGCTAGG - Intergenic
1066640476 10:37550125-37550147 GGGATGGAGAGGGGGTGGGTGGG - Intergenic
1066777458 10:38898921-38898943 GGAATGGAAAGGAATGGACTTGG + Intergenic
1067032026 10:42884610-42884632 GGCAGGGAGAGGGATGGGTTAGG + Intergenic
1067275143 10:44827555-44827577 GGAAGGGAGAGTGCTGAGCTGGG - Intergenic
1067675236 10:48369088-48369110 GGTATGGTGAGTTGTGGGCTAGG + Intronic
1068310721 10:55271138-55271160 GAAAGGGAGAGAGGTGGGCAGGG + Intronic
1069323546 10:67203590-67203612 GGAATGGAAAGGAGAGGGATAGG - Intronic
1069705950 10:70459083-70459105 GGAGTGGGGTGGGGTGGGATGGG - Intergenic
1069705952 10:70459088-70459110 GGCTTGGAGTGGGGTGGGGTGGG - Intergenic
1069843702 10:71356035-71356057 GAGATGGTGAGGGGTGGGCGAGG - Intronic
1069954803 10:72043415-72043437 GGAAGGGAGAGAGATAGGCTGGG + Intergenic
1070109029 10:73464236-73464258 GGAATTGAGATGGCTGGGCGTGG - Intronic
1070324760 10:75381025-75381047 GGAATGGAGATTGGAGGGCCTGG - Intergenic
1070417421 10:76203969-76203991 GGAATAGAGATGGGTGGGATGGG - Intronic
1070774870 10:79103647-79103669 GGAGTGGAGAGGGGAGCCCTGGG + Intronic
1070782780 10:79147188-79147210 GGTATGGGGAGGCCTGGGCTGGG + Intronic
1070955766 10:80462345-80462367 GGAATGGGGTGGGATGGGATGGG + Intronic
1070972515 10:80579140-80579162 GTGATGGAGAGAGATGGGCTGGG + Intronic
1070977730 10:80618869-80618891 GGAATGGAGGTGGAGGGGCTGGG + Intronic
1072576272 10:96703347-96703369 GGAATGGAGAGGGAGGGGCGAGG + Intronic
1072679844 10:97498805-97498827 GGAAGGGAGAGGGGCCGGCCTGG + Intergenic
1073087152 10:100899849-100899871 AGACTGGAGAGGGCTGGGCACGG - Intergenic
1074059134 10:109949037-109949059 GAGATGGACAGGGGTGGGGTGGG + Intronic
1074527675 10:114276214-114276236 GGAGTGGGGAGGGGTGGGTCAGG - Intronic
1074891349 10:117739006-117739028 AGAATAGGGAGGGCTGGGCTGGG - Intergenic
1075073109 10:119331839-119331861 GGAATGGAGAGCTGTTGGGTTGG - Intronic
1075091499 10:119446462-119446484 AGAAAGGCGAGGGGTGGGCTGGG - Intronic
1075257952 10:120940021-120940043 GGCCTGGAGTGGGGTGGGGTGGG - Intergenic
1075565314 10:123499261-123499283 GGAATAGATGGGGGAGGGCTTGG + Intergenic
1075627291 10:123972422-123972444 GGGGTGGAGAGGGGTGGGGATGG + Intergenic
1075856727 10:125636254-125636276 GGAATGCAGTGGTGTGGTCTTGG + Intronic
1076231417 10:128822835-128822857 GGAATGGGGATGGGTGGTTTGGG - Intergenic
1076438498 10:130462944-130462966 GGGAGGGACAGGGGTGGGGTGGG + Intergenic
1076555276 10:131317512-131317534 GGCATGGAGGGTGGAGGGCTTGG - Intergenic
1076610927 10:131725535-131725557 GGGATGCAGAGGCCTGGGCTAGG + Intergenic
1076701773 10:132276958-132276980 GGAATGGAGGAGGGGAGGCTGGG - Intronic
1077086238 11:752881-752903 GGAATGGAGAATGGTTGGTTGGG + Intronic
1077264321 11:1641633-1641655 GGTATGGGGTGGGGTGGTCTCGG - Intergenic
1077264474 11:1642107-1642129 GGTATGGGGTGGGGTGGTCTCGG - Intergenic
1077402929 11:2367903-2367925 GGAATGGAGGGGTCAGGGCTGGG + Intergenic
1077409825 11:2398770-2398792 GGAATGCAGTGAGATGGGCTTGG + Intergenic
1077423914 11:2465648-2465670 GAATTGGAGAGGGGAGGGGTGGG + Intronic
1077443611 11:2579945-2579967 GGAATGGAGTGGGGCTGGCCTGG - Intronic
1078083989 11:8222956-8222978 GGAATGGGCTGGGCTGGGCTGGG - Intergenic
1078366970 11:10714910-10714932 TGGATGTAGAGGGGTGGGGTGGG + Intergenic
1078467248 11:11559504-11559526 GGCATGGAGAGGGATGGGATAGG + Intronic
1078722474 11:13897392-13897414 GGAAGAGAAAGGGGTGAGCTAGG + Intergenic
1078806846 11:14714487-14714509 GGAATGCAGAGGTGTAGGCATGG - Intronic
1078826513 11:14935455-14935477 GGAATGAAGAGGGGAGGGCAGGG + Intronic
1079110713 11:17603595-17603617 GGAAGGGAGAGGGAGGAGCTTGG - Intronic
1079122482 11:17695810-17695832 GGACTGGAGAGCGCTGGGCAGGG + Intergenic
1079375245 11:19886582-19886604 GGAAAGGGGAGGGATGAGCTGGG + Intronic
1080360928 11:31512806-31512828 GGAATGGGGTTGGGTGGGCGGGG - Intronic
1080515517 11:33016052-33016074 GGGATGGCGCGGGGCGGGCTGGG + Intronic
1081502124 11:43677165-43677187 AGAATGGAGAAGGGGGGGTTTGG + Intronic
1081660556 11:44885557-44885579 GGGAGGGAGAGGGCTGGGCTTGG - Intronic
1081766231 11:45612299-45612321 GGCAAGGAGAGGAGGGGGCTTGG - Intergenic
1081770769 11:45649545-45649567 AGAAGGGAGTGGGGTGAGCTGGG + Exonic
1081958133 11:47111544-47111566 GGTGTGGAGTGGGGTGGGCTTGG - Intronic
1082132329 11:48506141-48506163 GGAGTGGGGAGGGGAGGGCAGGG - Intergenic
1083224587 11:61276863-61276885 GGAAAGGAGAGAGGAGGGATGGG + Intronic
1083446157 11:62709105-62709127 ACAATGGAGAGGGATGGGCCAGG + Exonic
1083680790 11:64351036-64351058 GGATTGGGGCGGGGTGGACTAGG + Intronic
1083990767 11:66244460-66244482 GGGGTGCAGAGGGCTGGGCTGGG - Exonic
1084005909 11:66323401-66323423 GGGCTGGAGAGGGGTTGGTTGGG + Intergenic
1084051259 11:66601564-66601586 GGAAAGGAGAGGGGAGGGGAGGG - Intronic
1084066190 11:66705644-66705666 GCACTGGAGAGGGAGGGGCTGGG - Intronic
1084734499 11:71095639-71095661 GGGATGGAGGGGGATGGGATGGG - Intronic
1085199183 11:74691419-74691441 GGAATGGGGAGGGGTGGGAGAGG + Intergenic
1085409782 11:76284242-76284264 GGGAGGGACAGGGCTGGGCTCGG - Intergenic
1085498800 11:76998013-76998035 GGAAGGGAGAGGGTTGGACTGGG + Intronic
1085861267 11:80238870-80238892 GGAATGCAGAGGAGAGGGGTGGG + Intergenic
1086942953 11:92816923-92816945 GGAATGCAGTGGGGTGATCTCGG - Intronic
1087097191 11:94330657-94330679 GGACTGGGGAGGGGTGGCATTGG - Intergenic
1087813213 11:102630948-102630970 GGCCTGGAGAGGAGTGTGCTGGG + Intergenic
1088985946 11:114908413-114908435 ATAAGGGAGAGGGGTGGGGTTGG + Intergenic
1089169130 11:116500234-116500256 GGAAAGGAGCAGGCTGGGCTAGG - Intergenic
1089305518 11:117524027-117524049 GGAGTGGAGAGAGGTGGGGTAGG + Intronic
1089401968 11:118169530-118169552 GGAAGGTAGGGGGCTGGGCTGGG - Intronic
1089461649 11:118657580-118657602 GGAAGGGAGAGGGCTGGACTGGG - Exonic
1089564486 11:119363723-119363745 GGAAAGGAGGGGTGGGGGCTGGG + Intronic
1090146246 11:124326063-124326085 GTAAGGGAGAAGGGTGGACTAGG + Intergenic
1090184144 11:124725314-124725336 GGAATGGAGAGGAGTGGAATGGG + Intergenic
1090404666 11:126469475-126469497 GGGAAGCAGAGGGGTTGGCTCGG + Intronic
1090496913 11:127222201-127222223 GGAATGGAGTGTGGTGGGCACGG - Intergenic
1090714421 11:129417440-129417462 TGGATGGAGAGTGGTGGGCTTGG + Intronic
1090812823 11:130262188-130262210 GGAGTGCAGCGGGGTGGTCTTGG + Intronic
1091015844 11:132050153-132050175 GGAAGGGAGAAGGGTGAGGTAGG + Intronic
1091491468 12:936251-936273 GGAATGCAGTGGTGTGGTCTCGG - Intronic
1091875767 12:3931702-3931724 GGAAGGGTGAGGGGTGGGCTGGG - Intergenic
1092447967 12:8575204-8575226 AAAATGGAGAAAGGTGGGCTGGG + Intergenic
1093122883 12:15294536-15294558 GGAGTGGGGAGGGGTGGCATTGG - Intronic
1093235720 12:16606534-16606556 GGAAAGAAGAGGGGAGGGGTGGG - Intronic
1093340895 12:17972898-17972920 GTAATGGAGAGGAGAGGGTTGGG - Intergenic
1093616549 12:21232562-21232584 GTAATGGAGAGGGGTGTCATAGG - Intronic
1094024184 12:25945196-25945218 GGAATGCAGTGGGGTGATCTTGG + Intergenic
1094056352 12:26273106-26273128 TGGATGGAGATGGGAGGGCTGGG - Intronic
1094761616 12:33539791-33539813 TGAATGGAGTGAGGTGGGCCAGG + Intergenic
1095180779 12:39144892-39144914 GGACTGGGGAGGGGCGGGCCTGG + Intergenic
1095874752 12:47068419-47068441 GGGATGGGGTGGGGTGGGGTGGG + Intergenic
1095966717 12:47872665-47872687 GGTATGAAGAGGGAAGGGCTGGG - Intronic
1095985110 12:47994191-47994213 GGTACGGGGAGGGGTGGTCTGGG - Intronic
1096073800 12:48789586-48789608 GGAATGGCTAGGTGGGGGCTGGG - Intergenic
1096180635 12:49548742-49548764 GGGGTGGAGAGGGGTGTGCTAGG + Intronic
1096318925 12:50593776-50593798 GGAAGGGAGAGGGGGGGGGAGGG - Intronic
1096627329 12:52903854-52903876 GGGGTGGGGTGGGGTGGGCTGGG - Intronic
1096793697 12:54060898-54060920 GGGATGGAGAGGGGAGATCTAGG + Intergenic
1097014407 12:55974797-55974819 GGAATGCTGAAGGGTGGGCTGGG + Intronic
1097192537 12:57226321-57226343 GGACTGGAGGGGGGCGGGCAGGG - Exonic
1097406731 12:59198369-59198391 GGAATGCAGTGGCGTGGTCTCGG - Intergenic
1098035940 12:66302356-66302378 GGAAGGGAGAGCGAGGGGCTGGG - Intergenic
1098389431 12:69953473-69953495 AGAATGGAGAGGGCTGGGCGTGG + Intronic
1098390904 12:69969017-69969039 GGATTTGAGAGTGGTGGGATGGG - Intergenic
1098435955 12:70468414-70468436 GGAGTGAAGAGGGGTGGGGTGGG - Intergenic
1098886920 12:75969659-75969681 CAAATGGGGAGGGGTGGGGTTGG + Intergenic
1099186529 12:79521374-79521396 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
1099681715 12:85837257-85837279 GGAATGGAGATGGGAGAGTTCGG + Intergenic
1099929559 12:89057965-89057987 GGAAGGGAAAGCTGTGGGCTGGG + Intergenic
1100386587 12:94109593-94109615 GGGGTTGAGAGTGGTGGGCTGGG - Intergenic
1100404851 12:94263887-94263909 GGAAGGGACAGGGTTGGGGTGGG + Intronic
1100479709 12:94966091-94966113 GGAAAGGAGAGGGGAGGGGAGGG + Intronic
1101302332 12:103495424-103495446 GGAAGGGGGAGGGGTGGGGGAGG - Intronic
1102177491 12:110886750-110886772 GGCATGGGGAGGTGTGGGGTGGG + Intronic
1102208616 12:111107641-111107663 GGAATGGAAAGGTCTGGGATGGG + Intronic
1102261799 12:111447544-111447566 GGTATGGGGTGGGGTGGGGTGGG + Exonic
1102415600 12:112759853-112759875 GGAATCTAGAGGGGTGTCCTGGG - Intronic
1102478246 12:113202644-113202666 GGAAAGGGGAGGAGAGGGCTTGG - Intronic
1102790423 12:115639759-115639781 GAAATGGAGAGGGGAGGCCTCGG - Intergenic
1102856950 12:116302458-116302480 GAGGTGGAGAGGGGTGGGCACGG + Intergenic
1102879612 12:116474190-116474212 GGAAAGGAGAGGGGAGGGGAGGG - Intergenic
1103188360 12:118980738-118980760 GGAGTGGATGGGGGTGGGGTGGG + Intergenic
1103510352 12:121469278-121469300 GGAATGGAGTGATGTGGGGTGGG - Intronic
1103631137 12:122261949-122261971 GGAATGCAGTGGCGTGGTCTCGG - Intronic
1103968672 12:124655965-124655987 GGGATGGAGCGTGGTGGGCAGGG - Intergenic
1104044953 12:125155373-125155395 GGCCTGGGGAGGTGTGGGCTGGG + Intergenic
1104256863 12:127146691-127146713 GGCAGGGAGAGGGGTGGCCATGG - Intergenic
1104557132 12:129811274-129811296 GGGATGGGGTGGGGTGGGCTCGG + Intronic
1104603671 12:130171343-130171365 GGAATGGGGAGGGCTGGGGTGGG - Intergenic
1104805756 12:131588263-131588285 GGAGTGGAGTGGAGTGGGGTGGG + Intergenic
1104805759 12:131588268-131588290 GGAGTGGAGTGGGGTGGGGTGGG + Intergenic
1104805762 12:131588273-131588295 GGAGTGGGGTGGGGTGGGGTGGG + Intergenic
1104805852 12:131588623-131588645 GGAATAGAGTGGGGTGGGGTGGG + Intergenic
1104862266 12:131929834-131929856 GGACTGGGGTGGGCTGGGCTGGG - Intronic
1104862268 12:131929839-131929861 GGGGTGGACTGGGGTGGGCTGGG - Intronic
1105258739 13:18763085-18763107 GGATGGGAGAGGGGTTGGATTGG - Intergenic
1105261410 13:18782388-18782410 GGATGGGAGAGGGGTGTGATTGG - Intergenic
1105497263 13:20941643-20941665 GGAATGCAGTGGGGTAGTCTTGG + Intergenic
1105515778 13:21089645-21089667 GGAGGGTAGAGGGGTGGGCACGG + Intergenic
1106177312 13:27342422-27342444 AGAATGCAGAGGTGTGGCCTGGG + Intergenic
1106447481 13:29849863-29849885 GACATGGAGAGGGGTGGGAGGGG + Exonic
1106684726 13:32046211-32046233 GAAATGGAGAGGGATGTCCTAGG - Intronic
1106778132 13:33027989-33028011 GGCAGGGAGAAGGATGGGCTGGG + Intronic
1107133369 13:36919820-36919842 GGAGTGGGGTGGGGTGGGGTGGG - Intronic
1107133372 13:36919825-36919847 GGGGTGGAGTGGGGTGGGGTGGG - Intronic
1107767850 13:43756506-43756528 GGAAAGGAGAGGGGAGGGAAAGG + Intronic
1107767858 13:43756522-43756544 GGAAAGGAGAGGGGAGGGGAGGG + Intronic
1109650247 13:65314402-65314424 GGAATAGATAGGGTTGGGTTGGG - Intergenic
1110525445 13:76531563-76531585 GGAATGCAGAGGCGTGATCTTGG + Intergenic
1110565190 13:76950710-76950732 GGATTGGAGAGGGGTAGACAGGG - Intronic
1112112392 13:96316509-96316531 GCAATGGAGAGGGGATAGCTAGG + Intronic
1112290278 13:98140187-98140209 GGAATGCAGTGGTGTGGTCTCGG + Intergenic
1112508381 13:99988966-99988988 GGCAGGGATAGGGGTGGGGTTGG - Intergenic
1112814172 13:103252398-103252420 GGATTGGGGAGTGGTGGGCCAGG + Intergenic
1112900563 13:104352520-104352542 GGGATGGAGTGGGATGGGCTGGG - Intergenic
1113066050 13:106375148-106375170 GGCATGGAGAGGCGAGCGCTGGG - Intergenic
1113401497 13:109998198-109998220 GGGAGTGAGAGGGGTGGACTTGG + Intergenic
1113442632 13:110341047-110341069 GGGGTGGGGAGGGGTGTGCTGGG + Intronic
1113517836 13:110916007-110916029 GGAACCGAGTGCGGTGGGCTAGG + Intergenic
1113557260 13:111247918-111247940 GGAATGGAGAGGTTAGGGCCAGG - Intronic
1113675245 13:112202517-112202539 GGAATGGAGATGGACGTGCTGGG - Intergenic
1113736430 13:112681693-112681715 GGAATGCAGTGGGGTGATCTTGG + Intronic
1113997482 14:16100302-16100324 GGAATGGTGTGGAGTGGGATGGG - Intergenic
1113997815 14:16102634-16102656 GGAATGGAGTGGGATGGAATGGG - Intergenic
1114261390 14:21039146-21039168 GGAAGGGAGAGAGGAGGGCCGGG - Intronic
1114296551 14:21334522-21334544 GGATTGGAGATGTGTGTGCTGGG + Intronic
1114454823 14:22847623-22847645 GGCATGGGGAGGGGTGGGGGTGG + Exonic
1116836996 14:49778537-49778559 GCAGTGGGGAGGGGTGGGGTAGG + Intronic
1117920948 14:60724450-60724472 GGAAAGGCGAGGGGTGGAGTGGG - Intergenic
1118408432 14:65451155-65451177 GGAGTTAAGAGTGGTGGGCTGGG - Intronic
1118438353 14:65791256-65791278 GGGGTGGGGAGGGCTGGGCTGGG + Intergenic
1118731543 14:68670362-68670384 GAACTGCAGAGGGGTGGGCCGGG - Intronic
1118748597 14:68791199-68791221 TGAAGGGGGCGGGGTGGGCTAGG - Intronic
1119635011 14:76266806-76266828 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
1119649422 14:76373324-76373346 GGGGTGGAGTGGGGTGGGCAGGG - Intronic
1119758362 14:77134341-77134363 GGAGGAGAGAGGGGTGAGCTGGG + Intronic
1120077389 14:80173951-80173973 GTCATGGAGAGGGTTTGGCTGGG - Intergenic
1120702462 14:87713098-87713120 GGAATGGAAAGTGATGGGATGGG - Intergenic
1121174904 14:91883721-91883743 GGAGTGGTGAGGGATGGGCAGGG + Intronic
1121240441 14:92426073-92426095 GGCAGGGAGAGAGGTGGGGTTGG + Intronic
1121326091 14:93020324-93020346 GAACTGGGGAGGGGTGGGCCAGG + Intronic
1121490474 14:94355437-94355459 AGGAAGGAGAGAGGTGGGCTGGG + Intergenic
1121553587 14:94820205-94820227 GGAAAGGAAAGGGGTGGCCAGGG - Intergenic
1121737040 14:96225890-96225912 GGAGTGGAGGGTGGTGGGCGGGG - Intronic
1122003957 14:98687095-98687117 GGAATGGAGTGGTGTGAGCTTGG + Intergenic
1122052041 14:99067128-99067150 GGAGTGGGGTGGGCTGGGCTGGG - Intergenic
1122052043 14:99067133-99067155 GGTCTGGAGTGGGGTGGGCTGGG - Intergenic
1122052227 14:99067778-99067800 GGACTGGACTGGGCTGGGCTGGG - Intergenic
1122116699 14:99531157-99531179 GGAGAGGAGGAGGGTGGGCTGGG + Intronic
1122418815 14:101562940-101562962 TGGATGGGGAGGGGTGGGCAGGG + Exonic
1122632131 14:103111898-103111920 GGAGGGGAGAAGGGAGGGCTTGG + Intergenic
1122791514 14:104185836-104185858 GGGATGGGGTGGGGTGGGGTGGG + Intergenic
1202834685 14_GL000009v2_random:69051-69073 GGATGGGAGAGGGGTGGGGTTGG + Intergenic
1202874396 14_GL000225v1_random:194416-194438 GGAATAGAAAGGGATGGACTGGG + Intergenic
1123692174 15:22847513-22847535 GGAATGCAGTGGGGTGATCTCGG + Intronic
1123696012 15:22879858-22879880 GGGGTGGGGTGGGGTGGGCTGGG + Intronic
1124950711 15:34317650-34317672 GGAATGCAGTGGGGTGATCTCGG - Intronic
1125761997 15:42103148-42103170 GTGATGGGGAGGGCTGGGCTTGG - Intergenic
1126915726 15:53464220-53464242 GAATTGGAGGGGTGTGGGCTGGG + Intergenic
1127657752 15:61071571-61071593 GGAGGGGAGAGGGGAGGGGTGGG + Intronic
1127657786 15:61071635-61071657 GGAGGGGAGAGGGGAGGGGTGGG + Intronic
1127861455 15:62997518-62997540 GGAATGCAAAGGGCTGGGCATGG + Intergenic
1127921829 15:63500765-63500787 TAAATGGAGAGGGGTGGGTGTGG - Intergenic
1128545074 15:68561210-68561232 GGCTGGGAGAGGGCTGGGCTGGG + Intergenic
1128558812 15:68651059-68651081 GGAATGGCGAGGGGTGGGGTGGG + Intronic
1128674399 15:69597979-69598001 TGAAGAGAGAGGGGTGGGCAGGG + Intergenic
1128729819 15:70013647-70013669 GGGGTGGAGAGGGGTGGTTTTGG + Intergenic
1129001778 15:72341502-72341524 GGAATGGGAAGGGGTGGGGGTGG + Exonic
1129008250 15:72392955-72392977 GGAATGCAGTGGTGTGGTCTTGG + Intergenic
1129011157 15:72418637-72418659 GGAATGCAGTGGCGTGAGCTTGG + Intergenic
1129198214 15:73983511-73983533 GGATTGGAGAGGGATGGGGAGGG - Exonic
1129808973 15:78490902-78490924 AGAATGGAGAGTGGCGGGGTGGG + Intronic
1129844488 15:78761989-78762011 GGAATGGACAGGCCAGGGCTGGG + Intronic
1129992691 15:79978472-79978494 GGACTGGAGTGGGGTGAGATTGG - Intergenic
1130257326 15:82331879-82331901 GGAATGGACAGGCTAGGGCTGGG - Intergenic
1130597619 15:85258110-85258132 GGAATGGACAGGCCAGGGCTGGG + Intergenic
1130957173 15:88636016-88636038 GGACTGGAGATGGCTGGACTGGG + Intergenic
1131187831 15:90291005-90291027 GGAATGCAGTGGCGTGAGCTTGG + Intronic
1131964824 15:97830737-97830759 GGCATGGAGAGGGGTGTTCAGGG - Intergenic
1132055424 15:98648118-98648140 GGAGAGGGGAGGGGTGGGCGGGG - Intergenic
1132421814 15:101676547-101676569 GGAATGCAGTGGTGTGGTCTTGG + Intronic
1132520369 16:384563-384585 GTAATGGAGAGGGCCGGGCGCGG + Intronic
1132559876 16:588755-588777 GGTCTGGAGAGGGCTGCGCTGGG + Intergenic
1132572991 16:652066-652088 GGCCTGGTGAGGTGTGGGCTGGG + Intronic
1132665050 16:1077828-1077850 TCCATGGAGAAGGGTGGGCTGGG - Intergenic
1132744861 16:1432356-1432378 GGCATGGAGAGAGATGGGGTGGG - Intergenic
1132958014 16:2606646-2606668 GGTCTGGAGAGGGGTTGGGTGGG + Intergenic
1133015147 16:2936395-2936417 GGGATGGAGAGGGCTGGGCAGGG - Intronic
1133018190 16:2954696-2954718 TGATTAGTGAGGGGTGGGCTGGG - Intergenic
1133040421 16:3057526-3057548 GGGATGGGGAAGGATGGGCTGGG - Exonic
1133201308 16:4206354-4206376 GGAATGGATGGGGGTGGGTTGGG - Intronic
1133270848 16:4610210-4610232 CTGATGGAAAGGGGTGGGCTGGG - Intronic
1133336930 16:5012318-5012340 GGAGGCCAGAGGGGTGGGCTGGG + Intronic
1134202457 16:12210261-12210283 GGACTGGAGAGGCTGGGGCTGGG + Intronic
1134433457 16:14233737-14233759 GGAATGCAGTGGGGTGATCTTGG - Intronic
1135303853 16:21352450-21352472 GGAAGGGGGAGGGCGGGGCTTGG + Intergenic
1135891630 16:26362744-26362766 GGAGTGCAGTGGGGTGAGCTTGG - Intergenic
1136249154 16:28992303-28992325 GGAATGCAGAGGCGTGATCTCGG - Intergenic
1136250517 16:29001486-29001508 GGAATGCAGAGGCGTGATCTCGG - Intergenic
1136300586 16:29331587-29331609 GGAAGGGGGAGGGCGGGGCTTGG + Intergenic
1136903203 16:34063309-34063331 GGAATGGAGAGGGATGGAATGGG + Intergenic
1136903448 16:34064893-34064915 GGAATGGAGAGGAATGGACTGGG + Intergenic
1136906357 16:34097085-34097107 GGAATGGAGAGGAATGGAATGGG - Intergenic
1136906465 16:34097786-34097808 GGAATGGAGAGGAATGGAATGGG - Intergenic
1136906624 16:34098846-34098868 GGAATGGAGCGGAGTGGAATGGG - Intergenic
1137344064 16:47638028-47638050 GGAATGGGGAGGGGTGCTTTGGG - Intronic
1137576835 16:49605542-49605564 GGAATGGAAGGAGGTGGGATGGG - Intronic
1137585739 16:49663389-49663411 GGCCTCGAGGGGGGTGGGCTGGG - Intronic
1137643809 16:50057241-50057263 GGAATGCAGTGGTGTGGTCTTGG - Intergenic
1137671419 16:50281717-50281739 GGGACAGAGAGGGCTGGGCTTGG + Intronic
1137715169 16:50594158-50594180 GGCATGGGGTGGGGTGGGGTGGG + Intronic
1138507268 16:57484620-57484642 GGCATGTTGAGGGGTGGGCAGGG - Intronic
1138534729 16:57653843-57653865 GGCAGAGAGAGGGGTGGGGTGGG - Intronic
1139372871 16:66479482-66479504 GGGGTGGAGAGGGGTGGGGAAGG + Intronic
1139468027 16:67164555-67164577 GGGGTGGAGTGGGGTGGGGTGGG - Exonic
1139482620 16:67238996-67239018 GGAATGCTGAGGGATAGGCTGGG - Intronic
1139534338 16:67562423-67562445 GGAAAGGTGAGGGGAGGGGTTGG - Exonic
1139614880 16:68082940-68082962 GGAATGGTGAGGGCTGGGACAGG - Intergenic
1139745478 16:69070822-69070844 GGAATGTAATGGGGTGGTCTTGG + Intronic
1139817650 16:69688424-69688446 GGAATGCAGTGGCGTGGTCTCGG + Intronic
1139908740 16:70383574-70383596 GGAAAGGAGAGGGGTGGGGAGGG + Intronic
1140128500 16:72137435-72137457 GGAATGGAGGGGCATGGGCGGGG + Intronic
1140151050 16:72366256-72366278 GGAAGGGAACGGGGTGGGGTAGG - Intergenic
1140224333 16:73066399-73066421 GAAATGGAGATGGGTGTGCCGGG - Intergenic
1140543169 16:75779037-75779059 GGAGTGCAGAGGGGTGATCTCGG + Intergenic
1140589512 16:76335095-76335117 GGAATGGGGTGGGGTGAGGTGGG + Intronic
1141202681 16:81910001-81910023 GGGATGGGGTGGGGTGGGGTGGG + Intronic
1141430832 16:83969471-83969493 GGAATGGAAGGGGGCGGGGTGGG - Intronic
1141572502 16:84942370-84942392 GGAGGGCAGAGGGGTGGGGTGGG - Intergenic
1141676888 16:85522390-85522412 GACATGGGGAGGGATGGGCTGGG - Intergenic
1141775777 16:86121816-86121838 GGAAGGGAGAGAGGTGGGGAGGG - Intergenic
1142156625 16:88535375-88535397 GGTATGGACAGGGCTGGGGTGGG - Exonic
1142228430 16:88888494-88888516 GGGTTGGGGAGGGGTGGGGTGGG + Intronic
1142359729 16:89620357-89620379 GAAATGGAGAGGAGGGGGCCTGG - Intronic
1142528792 17:564664-564686 GGAATGCAGTGGTGTGAGCTGGG - Intronic
1142563651 17:825902-825924 GGCATGGAGGAGGGAGGGCTGGG + Intronic
1142893180 17:2958158-2958180 GGGAGGCAGAGGGGTGGGGTGGG + Intronic
1142954511 17:3512333-3512355 CGATTGGGGAGAGGTGGGCTGGG - Intronic
1143023403 17:3928105-3928127 GGGCTGGAGAGAAGTGGGCTGGG - Intronic
1143174147 17:4947192-4947214 GGAAGGGAGGGGGGCGGGCGAGG + Intronic
1143179059 17:4973074-4973096 TGCAGGGAGTGGGGTGGGCTGGG - Intronic
1143573815 17:7778037-7778059 GAAAAAGAGAGAGGTGGGCTTGG - Intronic
1143697031 17:8629344-8629366 GGAAGGGGGTGGGGTGGGCTGGG - Intronic
1143712438 17:8744024-8744046 GGAAAGGAAGGGGGTGGGCTGGG - Intronic
1144686909 17:17232132-17232154 GGACAGGAGAGGGCAGGGCTGGG + Intronic
1144863951 17:18323110-18323132 GGTATGGGGAGGGGAGGGGTTGG + Exonic
1144867355 17:18345133-18345155 GGCATGGAGAGGTGGGGCCTGGG - Intronic
1145148758 17:20501819-20501841 GGCAGGGAGAAGGGAGGGCTGGG + Intergenic
1145305204 17:21670255-21670277 GAACTGGAAAGGGGTGGGCATGG + Intergenic
1145335912 17:21912324-21912346 GGAATGGAAAGGAGTAGACTGGG + Intergenic
1145884535 17:28372830-28372852 GGGAAGGAGAGCTGTGGGCTTGG - Intronic
1145965294 17:28912685-28912707 GGAATGGAAGGGGGCAGGCTTGG + Exonic
1146429047 17:32773510-32773532 GGTAGGGAGTGGGGTGGGGTTGG - Intronic
1146677721 17:34785052-34785074 GGAAAGGACAGGGCTGGACTAGG + Intergenic
1147003744 17:37385129-37385151 GGAATGGGTTGGGGTGGGCAAGG - Intronic
1147577285 17:41610085-41610107 GGCAGGGAGAAGGGAGGGCTGGG + Intronic
1147978039 17:44259132-44259154 GGGCCGGAGAGGGCTGGGCTGGG - Intronic
1148040872 17:44706119-44706141 GGAATGCAGTGGTGTGAGCTTGG + Intergenic
1148374115 17:47126842-47126864 GGAATGCAGAGGTGTGATCTGGG + Intronic
1148754229 17:49964213-49964235 GGATTGGGGACGCGTGGGCTGGG - Intergenic
1148805528 17:50262002-50262024 GGAGCGTAGAGGGGTGGGCAAGG - Intergenic
1148856596 17:50582355-50582377 GAAATGGAGAGCAGAGGGCTGGG + Intronic
1149927247 17:60713882-60713904 GGAGTGCAGAGGGGTGATCTCGG + Intronic
1150158205 17:62871696-62871718 GCAATGGAGAGGGGGCAGCTGGG - Intergenic
1150264681 17:63824615-63824637 GGTATGGAGTGGGGTAGGCACGG - Exonic
1150913561 17:69413427-69413449 GGAATGGAGAGGAGTGAGCAGGG - Intergenic
1151199173 17:72455275-72455297 GGGATGGGGTGGGGTGGGGTTGG - Intergenic
1151896352 17:76983285-76983307 GGAGGGGAGCGGGGTGGGTTTGG - Intergenic
1151907104 17:77056008-77056030 GGAATGGAGGCCTGTGGGCTGGG - Intergenic
1151951652 17:77357599-77357621 GGAAAGGAGAGGGGAGGGGAAGG - Intronic
1151963485 17:77419521-77419543 GGAAGGGGGAGGGGTCAGCTGGG - Intronic
1152119627 17:78410522-78410544 GGAATGCAGTGGCGTGGTCTTGG + Intronic
1152243937 17:79175594-79175616 GGGCAGGAGAGGGGTGGTCTAGG - Intronic
1152300176 17:79491046-79491068 GGAAAGGAGAGGGGAGGGGAGGG + Intronic
1152325774 17:79635007-79635029 GGAATGCAGTGGGGTGATCTCGG - Intergenic
1152327929 17:79652512-79652534 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
1152571968 17:81124906-81124928 TGAGTGGGGTGGGGTGGGCTGGG - Intronic
1152572208 17:81125804-81125826 GGGGTGGAGTGGGGTGGGTTGGG + Intronic
1152656414 17:81521473-81521495 GGGATGGAGAGGGCTGAGGTGGG - Intronic
1152658191 17:81529658-81529680 AGACTGGAGAGGTGTGGGCCAGG + Intronic
1152706668 17:81847192-81847214 GGGATGGGGAGGAGTGGGTTGGG - Intronic
1152789812 17:82273055-82273077 GGTCTGGAGAGGGGAGGGTTGGG - Intronic
1152814523 17:82399632-82399654 GGAATGGAGAGGGCAGGACTGGG - Intronic
1152885268 17:82845643-82845665 GGAAGGGACCGGGGTGGGCTGGG - Intronic
1203199762 17_KI270729v1_random:264883-264905 GGAATGGAGTGGAGTGGAATGGG + Intergenic
1203201604 17_KI270729v1_random:280188-280210 GGAATGGAGTGGAGTGGAGTGGG + Intergenic
1203209357 17_KI270730v1_random:65592-65614 GGAATGGAGTGGAGTGGAATGGG + Intergenic
1203211205 17_KI270730v1_random:80914-80936 GGAATGGAGTGGAGTGGAGTGGG + Intergenic
1203213559 17_KI270730v1_random:102996-103018 GGAATGGAGTGGAGTGGAGTGGG + Intergenic
1203213807 17_KI270730v1_random:104571-104593 GGAATGGAGAGGAATGGAATGGG + Intergenic
1153071223 18:1106841-1106863 GGGATGGGGTGGGGTGGGGTGGG - Intergenic
1153261238 18:3226423-3226445 GGAATGGAGAGGGGCGGAGCTGG - Intergenic
1154177517 18:12094631-12094653 GGACTGGTGGGGGGTGGGATGGG + Intronic
1154233087 18:12576150-12576172 GGAATGCAGTGGGGTGATCTCGG - Intronic
1154424615 18:14262421-14262443 GGATGGGAGAGGGGTGGGATTGG + Intergenic
1154427293 18:14281771-14281793 GGATGGGAGACGGGTGGGGTTGG + Intergenic
1154430018 18:14301306-14301328 GGATGGGAGACGGGTGGGGTTGG + Intergenic
1154432307 18:14317646-14317668 GGATTGGAGAGGGGTTGGATTGG + Intergenic
1155027719 18:21957603-21957625 AGAATGGAGATGGCTGGGCATGG - Intergenic
1155065911 18:22268624-22268646 GGAAGGAAGAGTGGTGGGCATGG + Intergenic
1155137757 18:23013312-23013334 GGAATGGAGATTGGTTGGGTTGG + Intronic
1155409091 18:25522622-25522644 GGAATGAAGAGGGAAGGTCTAGG - Intergenic
1155454573 18:25997630-25997652 GAAGTGGAGAGGTGTAGGCTGGG + Intergenic
1156508158 18:37612183-37612205 GTCTGGGAGAGGGGTGGGCTGGG + Intergenic
1157499179 18:48178026-48178048 GGCAAGGAGAGGGAGGGGCTGGG - Intronic
1158541109 18:58355252-58355274 GGAATAGAGAGGGTTGGTCCGGG + Intronic
1158938225 18:62384459-62384481 GGAAGGGGGAGGAGAGGGCTAGG - Intronic
1158987626 18:62834870-62834892 GGGATGGAGAGGAGTGGGAGAGG - Intronic
1159339815 18:67119874-67119896 GGGATGGGGAGGGGTGGCGTTGG + Intergenic
1159769076 18:72527278-72527300 GGAATGGAGAAGGTAGGGGTTGG + Intergenic
1159964109 18:74579315-74579337 GGGATGGAGAGGGGAGGGGAAGG - Intronic
1160393795 18:78557663-78557685 GGAAAGGAAAGATGTGGGCTTGG - Intergenic
1160710749 19:549935-549957 AGCATGGACAGAGGTGGGCTGGG - Intergenic
1160739991 19:681175-681197 GGAATGGAGAGGGGGGCTCACGG + Intronic
1160777522 19:862818-862840 GGCTTGGAGCGGGGTGGGGTCGG + Intronic
1160913772 19:1487367-1487389 GGAGTGGCGCGGGGCGGGCTGGG - Intronic
1161093907 19:2377627-2377649 GGAGGGGAGAGGGGAGGGCAGGG - Intergenic
1161512419 19:4679129-4679151 GTAGTGGAGAGGGTGGGGCTCGG - Intronic
1161734630 19:5983940-5983962 GGAATGGGAAGGGCTAGGCTGGG - Intergenic
1162811174 19:13165004-13165026 GGCATGGACAGGGATGGGGTCGG + Intergenic
1162935020 19:13977964-13977986 TGAAGGGAGAGGGGTGGGTGAGG - Intronic
1163158929 19:15453428-15453450 GGAGATGAGAGGGGTGTGCTTGG + Exonic
1163489171 19:17606811-17606833 GGAAGTAAGAGGGGTGGGCTGGG - Intronic
1163530153 19:17844081-17844103 GTAATGGAGAAGGGTGTGCAGGG - Intronic
1163608758 19:18290484-18290506 TGAATGGGGAGGGGTGGGGGAGG + Intergenic
1164400590 19:27899591-27899613 GGAATGTGGAAGGGTGGGCATGG + Intergenic
1164533282 19:29064084-29064106 GCACTGGACAGGGGTGGGATGGG + Intergenic
1165349029 19:35266773-35266795 GTAAGGGAGAGGGGTGGGCCAGG + Intronic
1165491426 19:36125640-36125662 GGAAAGGATAGGGGTGGGTGTGG - Intronic
1165904498 19:39185416-39185438 GGGGTGGAGAGGTGTTGGCTGGG + Intergenic
1166083712 19:40461283-40461305 GGATTGGAGAGGGCAGGACTGGG - Intronic
1166107853 19:40606204-40606226 CGAGAGGAGAGGGGTGGGCCAGG - Intronic
1166167829 19:41004611-41004633 GGAATAGAGAGGGATGGGGATGG + Intronic
1166256151 19:41606294-41606316 GGACTGGGGAGGGAAGGGCTTGG + Intronic
1166327739 19:42061667-42061689 GGAAAGAAGAGGGTGGGGCTAGG - Intronic
1166409421 19:42546827-42546849 GGGATGGAGAGGGGAGGGGAGGG + Intronic
1166684368 19:44787032-44787054 GGAATGCAGAGGCGTGATCTTGG - Intronic
1166749842 19:45159503-45159525 GGCGTGGAGAGGGGTAGGCCAGG + Intronic
1166843237 19:45711634-45711656 GGAGAGGGGAGGGGTGGGCGTGG + Exonic
1166872840 19:45881395-45881417 AGAATGGACAGGGCTGGGATTGG + Intergenic
1167014981 19:46835299-46835321 GGAAAGGAGAGGGGAGGGGAGGG - Intergenic
1167474689 19:49692940-49692962 GGAATGCAGTGGGGTGATCTTGG + Intronic
1167575376 19:50315331-50315353 GGAATGGGGCGGGGGAGGCTCGG - Intronic
1167601515 19:50457728-50457750 GGAATGCAGTGGGGTGATCTCGG + Intronic
1167786885 19:51644526-51644548 GGACTGGAGAGAAGTGGGATAGG + Intronic
1168236736 19:55068485-55068507 GGAGTGCAGAGGTGTGGTCTCGG - Intronic
1168338528 19:55610816-55610838 GGACTGGAGAGTGATGGGGTGGG + Intronic
1202638014 1_KI270706v1_random:58642-58664 GGATGGGAGAGGGGTGGGGTTGG - Intergenic
925579134 2:5392472-5392494 GAACTGGTGAGGGGAGGGCTGGG - Intergenic
925885399 2:8390687-8390709 GGGATGGGGTGGGGTGGGATGGG + Intergenic
925885448 2:8390820-8390842 GGGATGGGGTGGGGTGGGGTGGG + Intergenic
925913744 2:8589658-8589680 GGAGAGGAGAGGGGAGGGCAGGG + Intergenic
926156165 2:10455104-10455126 GGAGTGGACAGGGCTGGCCTTGG - Intergenic
926351739 2:12001701-12001723 TGAATGGAGAAGAGTAGGCTGGG + Intergenic
926591963 2:14749896-14749918 GGAATGGTGAGGAATGGGATTGG + Intergenic
926669291 2:15561084-15561106 GGAGTGGAGACGGGTGGGTGGGG - Intronic
927216866 2:20672330-20672352 GGAATGGGGAAGGTGGGGCTGGG + Exonic
927563213 2:24088399-24088421 GGAATGCAGTGGGGTGATCTCGG + Intronic
927923999 2:26996754-26996776 GGAATGCAGAGGTGTGATCTTGG - Intronic
927999163 2:27507793-27507815 GGAGTGGTGAGGGGTGGGGAGGG + Intronic
928361445 2:30665136-30665158 GGGATGGGGTGGGGTGGGGTGGG + Intergenic
928362862 2:30679663-30679685 GGCAATGAGAGGGTTGGGCTTGG + Intergenic
928424722 2:31168536-31168558 GGAGTGGAGGGGGCTGGCCTGGG + Intergenic
928978106 2:37110119-37110141 GGAATGCAGTGGCGTGGTCTCGG + Intronic
928989951 2:37222231-37222253 GGAATGCAGAGGCGTGATCTCGG - Intronic
929436445 2:41932305-41932327 GGAACGGAGCTGGGTGGGGTGGG - Intergenic
929561183 2:42957563-42957585 GGAAGGTAGTGGGGTGGGCCTGG + Intergenic
929712722 2:44281133-44281155 GGAAAGGAGAGGGGAGGGGAGGG - Intronic
929816508 2:45237156-45237178 GGAAGTGAGAGGGGTGGAGTGGG + Intergenic
930029360 2:47048941-47048963 GGAATGGGAAGGGGTGGGAGAGG + Intronic
930076407 2:47409103-47409125 GGAAAGGGGAGGGGAGGGCAGGG + Intronic
930288956 2:49468837-49468859 GGAATGGAGAGGGGTGACCTCGG + Intergenic
930811523 2:55546651-55546673 GGAATGCAGTGGCGTGAGCTCGG - Intergenic
930947598 2:57093470-57093492 GGATTGGAGAGGGGTGGCATAGG + Intergenic
931285158 2:60825847-60825869 GGGATGGAGGGGGTTGGACTTGG - Intergenic
931825705 2:65998280-65998302 GAAATGCAAAGTGGTGGGCTTGG - Intergenic
932039457 2:68283808-68283830 GGAAGAGAGAGGCATGGGCTGGG - Intergenic
932196252 2:69786562-69786584 GGAAATCAGAGGGGTGGGCTGGG - Intronic
932215281 2:69962365-69962387 GAAATGGAGAGGGGTGGATAGGG - Intergenic
932232708 2:70095758-70095780 GGAAAGGAGGGGCGAGGGCTTGG - Intergenic
933663416 2:84945804-84945826 GGAATGGTGGGGGATGGGGTGGG + Intergenic
933822194 2:86123209-86123231 GGAATGCAGTGGCGTGGTCTTGG - Intronic
934493432 2:94778099-94778121 GGATGGGAGAGGGGTGGGGCTGG - Intergenic
934533582 2:95113423-95113445 GGAATGCAGTGGCGTGGTCTCGG - Intronic
934554307 2:95279164-95279186 GGGATGGGGTGGGGTGGGGTGGG + Intronic
934558559 2:95300412-95300434 GGGATGCCCAGGGGTGGGCTGGG - Intronic
934652154 2:96098872-96098894 GGAATGGAGAAGGGAGGGTGGGG + Intergenic
934865305 2:97804367-97804389 AGAAAGGAAGGGGGTGGGCTGGG + Intronic
935063297 2:99626557-99626579 GGAAAGGAGAGGGGAGGGGAGGG - Intronic
935308391 2:101759627-101759649 GGAATGGGGAGGGGAGGGAAGGG - Intronic
935308423 2:101759685-101759707 GGAATGGGGAGGGGAGGGGGAGG - Intronic
935695750 2:105769272-105769294 GGGATGGGGAGGGGAGGGGTGGG - Intronic
936018913 2:108980086-108980108 TGAATGGTGTGGGGTGGGGTGGG + Intronic
936865981 2:117077073-117077095 GGGATGGGGTGGGGTGGGATGGG - Intergenic
937099145 2:119255256-119255278 GGGGTGGAGGGTGGTGGGCTAGG - Intronic
937371545 2:121301239-121301261 TGAATGGAGAAGGTTGGGTTTGG + Intergenic
937895861 2:126976503-126976525 GGAGGGCAGAGGTGTGGGCTTGG - Intergenic
938134902 2:128748787-128748809 GGAATGGAGAGGATGGGGCACGG + Intergenic
938580091 2:132637919-132637941 GGAAGGGAGAGGTGTGGGCTGGG + Intronic
938694346 2:133822022-133822044 GGAATGGAGATGGGAGGGGTAGG + Intergenic
938833741 2:135078693-135078715 GGAAAGGAGAGGGGAGGGGAGGG - Intronic
940754655 2:157668321-157668343 TGAATGGAGTGGGGTGGGAAGGG + Intergenic
940917038 2:159267244-159267266 GGCATAGATAGGGGTGGCCTTGG - Intronic
940946403 2:159623075-159623097 GGAAGGGAGAGGGGAGGGAGAGG + Intergenic
941632282 2:167897908-167897930 GGAATGCAGTGGCGTGGTCTCGG + Intergenic
942422255 2:175820328-175820350 GGAATGGAGAGGGATGGGCTAGG + Intergenic
945655368 2:212616597-212616619 GGAAGGGAGAGGGGAGGGGAGGG - Intergenic
945655383 2:212616631-212616653 GGAAGGGAGAGGGGAGGGGAGGG - Intergenic
945834927 2:214828224-214828246 GGAATGCAGTGGGGTGATCTTGG + Intergenic
946325063 2:218980845-218980867 GGAAGGGAGTGAGGTGAGCTGGG + Intergenic
946331076 2:219009667-219009689 GGGATGGGGTGGGGTGGGGTGGG + Intronic
946331098 2:219009722-219009744 AGAATGGGGTGGGGTGGGATGGG + Intronic
946331108 2:219009747-219009769 GGGATGGAGTGGGGTGGGATGGG + Intronic
946331117 2:219009772-219009794 GGGATGGAGTGGGGTGGGATAGG + Intronic
946331132 2:219009802-219009824 GGGATGGAGTGGGGGGGGATGGG + Intronic
946331151 2:219009851-219009873 GGGATGGAGTGGGGTGGTATGGG + Intronic
946738131 2:222774840-222774862 GGAGTGCAGTGGGGTGGTCTCGG - Intergenic
947328890 2:229007473-229007495 GGGATAAAGAGGGGTGGGCATGG + Intronic
947428657 2:230006666-230006688 GGAATGAAGTGGGAGGGGCTGGG + Intronic
947728983 2:232417868-232417890 GGAAAGCAGAGGGGAGAGCTAGG + Intergenic
947744986 2:232502897-232502919 GGAGTGGAGCGGGGTGGTGTTGG + Intergenic
947964095 2:234264619-234264641 GGAATGGGGTGGGGTGGGGATGG - Intergenic
947964097 2:234264624-234264646 GGAAGGGAATGGGGTGGGGTGGG - Intergenic
948046226 2:234947525-234947547 GGAGTGGAGAGGGGCGTGCTGGG - Intergenic
948151643 2:235749331-235749353 GGAATGGATGGGGCAGGGCTGGG + Intronic
948189375 2:236046102-236046124 GGCATGGAGGGCGGTGGGGTGGG + Intronic
948255822 2:236567667-236567689 GGAATGGGGCGGGGTGGGTCGGG - Intergenic
948887319 2:240890788-240890810 GGAAGGGGAAGGGCTGGGCTGGG - Intronic
1168789062 20:563781-563803 GGGATGGGAAGGGGTGGGCCAGG + Intergenic
1169208636 20:3753774-3753796 GGAAGGGAGAGGGAGGGCCTGGG - Exonic
1169300857 20:4440892-4440914 GGAATAGGGATGGGTAGGCTGGG + Intergenic
1169378868 20:5089322-5089344 GGAATGCAGTGGGGTGATCTTGG - Intronic
1170739687 20:19044264-19044286 GAGCTGGAGATGGGTGGGCTTGG + Intergenic
1171214126 20:23339992-23340014 GGAATGCAGAGGGCAAGGCTGGG + Intergenic
1171266557 20:23776281-23776303 GGCATGGAGTGGGGTGGGCTGGG - Intergenic
1171351689 20:24507503-24507525 GAGCTGGAGAGGGATGGGCTAGG - Intronic
1171402797 20:24889335-24889357 GGAGTGCAGTGGGGTGGTCTCGG - Intergenic
1171868843 20:30510428-30510450 GGGATGGGGTGGGGTGGGATGGG - Intergenic
1171884583 20:30642703-30642725 GGATGGGAGAGGGGTGGGGTTGG - Intergenic
1171917716 20:31073509-31073531 GGAATGGAATGGGATGGGATGGG + Intergenic
1172016736 20:31879996-31880018 GGAATGGGTAGGGGTGGGGCGGG + Intronic
1172105649 20:32515775-32515797 GCCATGGAGAAGGGTGAGCTAGG + Intronic
1172199307 20:33114040-33114062 GGACTAGGGAGAGGTGGGCTGGG - Intergenic
1172588158 20:36099561-36099583 GGAGAGGAGCGGGCTGGGCTGGG - Intronic
1172608290 20:36230533-36230555 CTAATGGAGAGGTGTGGGTTTGG + Exonic
1172662050 20:36574470-36574492 GGAAGGGAGGGGAGGGGGCTGGG - Intronic
1172738672 20:37148805-37148827 GGATTGGGGAGAGGTGGGCATGG - Intronic
1172811262 20:37649955-37649977 AGAAGGGAGAAGGGAGGGCTCGG + Intergenic
1173372241 20:42447416-42447438 GGAATGCAGAGGGAAGGGCATGG - Intronic
1173576161 20:44114144-44114166 GAAGTGGAGTGGGCTGGGCTGGG - Intronic
1173893532 20:46531814-46531836 GGGATGGGGTGGGGTGGGGTGGG + Intergenic
1174039461 20:47688646-47688668 TGGGTGGAGAGGAGTGGGCTTGG + Intronic
1174056169 20:47800100-47800122 GGAGGGAAGAGGGGTGGGGTGGG - Intergenic
1174107320 20:48171972-48171994 GGACTGGGCAGGGGTGGGGTAGG - Intergenic
1174145588 20:48450309-48450331 GGGATGGGGTGGGGTGGGGTGGG + Intergenic
1174145602 20:48450339-48450361 GGGATGGGGTGGGGTGGGATGGG + Intergenic
1174343378 20:49911990-49912012 GGAATGGGGATGGGTGGGACAGG + Intronic
1174371245 20:50089586-50089608 AGAGTGGAGAGAAGTGGGCTTGG + Intronic
1174483301 20:50845764-50845786 GGAGTGGAGAGGGCTGAGGTGGG + Intronic
1174524939 20:51163248-51163270 GGAAGGCACAGGGGTGGGGTGGG + Intergenic
1174604975 20:51754763-51754785 GGAATGCAGTGGTGTGGTCTTGG - Intronic
1174611128 20:51800216-51800238 TGAATGGAGAGTGCTGGGCTGGG - Intronic
1174840035 20:53892817-53892839 GGAAGGGAGAGGGGAGGGGAAGG - Intergenic
1175278610 20:57788093-57788115 GGGGTGGAGAGGGATGGGGTGGG + Intergenic
1175301212 20:57943903-57943925 GGAAAGGAGAGAGGTGGGGGAGG - Intergenic
1175380563 20:58559637-58559659 GGAAGAGGGAGGGGTGGGCTGGG + Intergenic
1175863040 20:62160273-62160295 GGGATGGGGAGAGGTGGGGTGGG + Intronic
1175863090 20:62160398-62160420 GGGATGGGGAGAGGTGGGATGGG + Intronic
1175895457 20:62333834-62333856 GGAGTGGGGTGGGGTGGGGTGGG + Intronic
1175895459 20:62333839-62333861 GGGGTGGGGTGGGGTGGGCTGGG + Intronic
1176191513 20:63812726-63812748 GGAGTGCAGTGGGGTGGTCTTGG - Intronic
1176306651 21:5127032-5127054 GAACTGGAGAGGGGAGAGCTGGG - Intronic
1176530871 21:7956950-7956972 GGAGTGGAGAGGAGTGGAGTAGG - Intergenic
1176753429 21:10708314-10708336 GGAATGGAGTGGAGTGGAGTGGG - Intergenic
1176755219 21:10720887-10720909 GGAGTGGAGTGGAGTGGGGTGGG - Intergenic
1176755529 21:10722903-10722925 GGAATGGAGTGGAGTGGAATGGG - Intergenic
1176756269 21:10727992-10728014 GGAATGGAGTGGAGTGGAGTGGG - Intergenic
1176844732 21:13868105-13868127 GGATGGGAGAGGGGTTGGATTGG - Intergenic
1178260721 21:31097652-31097674 GGAATGTAGATGTGTGTGCTGGG - Intergenic
1178686901 21:34719002-34719024 AGAATCAAGAGGTGTGGGCTGGG - Intergenic
1178817965 21:35948982-35949004 GGAATGGATAGGGATGGGAAAGG - Intronic
1178867847 21:36345225-36345247 GGAAAGGAGAGGGCAGGGCAGGG - Intronic
1178928427 21:36795001-36795023 GGGAGGGAGAGGTCTGGGCTAGG + Intronic
1179035059 21:37752562-37752584 GGAATAGAGAGGGAGGTGCTGGG + Intronic
1179242136 21:39601927-39601949 GAAATGGTGAGGCCTGGGCTGGG + Intronic
1179850406 21:44134998-44135020 GAACTGGAGAGGGGAGAGCTGGG + Intronic
1179891928 21:44339528-44339550 GGAACCGAGCGGGGTGGGCTCGG + Intergenic
1179910183 21:44443331-44443353 GAGCTGGAGAGGGGTGGGGTGGG - Intergenic
1179968521 21:44820221-44820243 GGAAAGGTCAGGGCTGGGCTGGG + Intergenic
1180282780 22:10718486-10718508 GGAATGGAAAGGAATGGACTTGG - Intergenic
1180363955 22:11923237-11923259 GGATGGGAGAGGGGTGGGGTTGG + Intergenic
1180620225 22:17156723-17156745 GGAGTGGAGTGGCGTGGTCTCGG - Intronic
1181438882 22:22925500-22925522 GGAATGGAGGGGATTGGGCTTGG - Intergenic
1181494550 22:23280654-23280676 GAGAAGGAGAAGGGTGGGCTCGG + Intronic
1181496828 22:23291991-23292013 GGCCTGGAGAAGAGTGGGCTGGG - Intronic
1181509910 22:23384553-23384575 GGACTGGAGTGGGGTGGGCCGGG + Intergenic
1181674608 22:24443630-24443652 GCAATGGAAAGGGCTGGGCGCGG - Intergenic
1181911978 22:26245456-26245478 CAAATGGGGAAGGGTGGGCTTGG - Intronic
1182169983 22:28218797-28218819 GGGCTGGAGTGGGGTGGGGTGGG - Intronic
1182686174 22:32122807-32122829 TGGGTGGAGGGGGGTGGGCTGGG + Intergenic
1182895395 22:33855380-33855402 GGAAGGTAGAGGGGTGGAGTGGG + Intronic
1182944438 22:34308775-34308797 GGAGTGGAGTGGGGTGGAGTGGG - Intergenic
1183300482 22:37056689-37056711 GGGATAGAGAGGGGTGGGAATGG + Intronic
1183364580 22:37400228-37400250 GGACCGGAGTGGGGTGGGATGGG - Intronic
1184100710 22:42340621-42340643 GGGGTGGAGTGGGGTGGGCCAGG - Intronic
1184151754 22:42643633-42643655 GCATGGGTGAGGGGTGGGCTAGG - Intronic
1184626376 22:45734933-45734955 GGAATGCAGAGGTGTGGTCTTGG + Intronic
1184730518 22:46368856-46368878 AGAGTGGAGATGGGTGGGGTGGG - Intronic
1184769370 22:46588710-46588732 GGGATGGAGAGGGCGGTGCTGGG - Intronic
1184944585 22:47794097-47794119 GGAAGGGAAAGGTGTGGACTGGG - Intergenic
1185061249 22:48607977-48607999 GGCCTGGAGAGGGATGGGCCCGG - Intronic
1185331580 22:50254360-50254382 GGCAAGGAGAGGGCTGGGCGCGG + Intronic
1203299835 22_KI270736v1_random:69291-69313 GGAATGGAGTGGAGTGGAATGGG + Intergenic
1203302292 22_KI270736v1_random:85557-85579 GGAATGGAATGGAGTGGGGTGGG + Intergenic
1203313230 22_KI270736v1_random:157387-157409 GGAATGGAAAGGAGTGGAGTGGG + Intergenic
1203315022 22_KI270736v1_random:180807-180829 GGAATGGAGTGGAGTGGAGTGGG + Intergenic
1203317137 22_KI270737v1_random:25006-25028 GGAATGGAATGGTTTGGGCTCGG - Intergenic
949501463 3:4684090-4684112 GGAAGGGATAGTAGTGGGCTGGG - Intronic
950125128 3:10505930-10505952 GGCACGGAGAGGGTAGGGCTGGG + Intronic
950164253 3:10781489-10781511 GGAAAGGTGAGGGGTGAGTTAGG - Intergenic
950390728 3:12694491-12694513 TGCATGGTGCGGGGTGGGCTGGG - Intergenic
950675828 3:14553887-14553909 GGAGTGGAGAGGGGTCGGGCAGG + Intergenic
950912521 3:16609364-16609386 GGAATGCAGTGGGGTGATCTTGG - Intronic
950979772 3:17289581-17289603 GGAGTGCAGAGGTGTGGTCTCGG - Intronic
952149097 3:30567169-30567191 GGATAGGGGAGGGGTGGTCTTGG - Intergenic
952555574 3:34526139-34526161 GAAATTGAGAGGGGCAGGCTAGG - Intergenic
953343546 3:42156123-42156145 GGGATGGAGAGGGCTGGGCCAGG - Intronic
953577211 3:44122694-44122716 GGAAACAAGAGGGCTGGGCTAGG - Intergenic
953680561 3:45035431-45035453 GGGATGGAGGACGGTGGGCTTGG + Intronic
953795205 3:45979862-45979884 GGAATGAAGAGCAGTGGGTTTGG - Intronic
953891853 3:46756742-46756764 GGAGTGGACAGGGCGGGGCTGGG - Intronic
953912517 3:46900097-46900119 AGACTGCAGAGGGGTGGGCCGGG + Intronic
954314875 3:49795633-49795655 CCAATGGAGAAGAGTGGGCTGGG + Exonic
954464931 3:50648723-50648745 GGAATAGTGAGGGGATGGCTAGG - Exonic
955667694 3:61367994-61368016 GGTATGGGGAGGGGTGACCTGGG - Intergenic
955770967 3:62384369-62384391 GGAATGCAGTGGGGTGATCTGGG + Intergenic
956202653 3:66722461-66722483 GAAATGGAGGAGGCTGGGCTCGG - Intergenic
957265658 3:77961643-77961665 GGAATGGCTTGGGCTGGGCTGGG + Intergenic
957567702 3:81906157-81906179 GTAATGGAGAGGAGTGGAATAGG + Intergenic
959126074 3:102291396-102291418 GGAAGGGAGAGGGTTGGCTTTGG + Intronic
959890437 3:111549168-111549190 GGAAAGGAGAGGGGAGGGGAGGG - Intronic
960004516 3:112768149-112768171 AGAATGGAAAGGGCTGGGCGTGG + Intronic
960223785 3:115147077-115147099 GGAGGGGAGCGGGGTGGGGTTGG - Intronic
960623631 3:119659875-119659897 GGAAATGAGAAGTGTGGGCTGGG + Intronic
961594599 3:128006579-128006601 GGGATGGAGCTGGGTGGGCAGGG + Intergenic
961611408 3:128142829-128142851 GGAATGTAGAGGGGTGATCTTGG + Intronic
961668691 3:128510661-128510683 GGAATGGTGAAGGGTGGGCAGGG - Intergenic
962061858 3:131936359-131936381 GCAATGGATGGGGGTGGGGTGGG + Intronic
962237376 3:133718085-133718107 GGAAGGGAGAGTGGTGGGAAGGG + Intergenic
962715912 3:138125924-138125946 GAATTGGAGAGGGGTGGGGAGGG + Intronic
962744553 3:138387877-138387899 GGAATGGAGTGAGGGGGTCTTGG - Intronic
962971233 3:140403864-140403886 TGAATGAAGTGGGGTGGGCACGG - Intronic
964042531 3:152279371-152279393 GGGATGGGGAGGGATGGGGTTGG - Intronic
964843126 3:161015976-161015998 GGAAAGGAGAGATGTGGCCTGGG + Intronic
965520831 3:169666821-169666843 GGAAAGGCGAGAGGTGGGGTGGG - Intergenic
966193543 3:177292317-177292339 GGAATGCAGTGGTGTGGTCTCGG + Intergenic
966817014 3:183897554-183897576 GGAATGCAGAGGCGTGATCTTGG - Intergenic
966860541 3:184229219-184229241 GGCAGGGGGTGGGGTGGGCTGGG + Intronic
967054866 3:185823554-185823576 GGAATGGAGAGGTGGGGGCCGGG - Intronic
967240322 3:187432532-187432554 AGACTGGAGTGGGGTGGGGTTGG + Intergenic
967851853 3:194088371-194088393 GGAAAGCAGAGGGCCGGGCTGGG + Intergenic
968132805 3:196201882-196201904 GGAATGGGGAGAGGGGGGTTGGG - Intronic
968186476 3:196636291-196636313 GGGATGGGGAGGGTTGGGGTAGG + Intergenic
968317978 3:197740190-197740212 GGAAAGTAGAGGGATGGGATAGG - Intronic
968427377 4:532909-532931 GGAATGGAGAGGTGGGGCCTAGG + Intronic
968427390 4:532951-532973 GGAGTGGAGAGGCGGGGCCTGGG + Intronic
968427402 4:532993-533015 GGAATGGAGAGGTAGGGCCTAGG + Intronic
968427407 4:533014-533036 GGAGTGGAAAGGTGTGGTCTTGG + Intronic
968446107 4:653152-653174 GGCAGGGAGAGAGCTGGGCTAGG + Intronic
968523709 4:1046024-1046046 GGAAGGGCTCGGGGTGGGCTCGG - Intergenic
968705252 4:2074637-2074659 GGCCTGGAGAGGGTGGGGCTAGG + Intronic
968764906 4:2463063-2463085 GGAAGGGAGAGGGGTGCGGTCGG - Intronic
969062697 4:4450652-4450674 GGGATGGAGAGGGGTGGTAGAGG - Intronic
969307714 4:6335375-6335397 TGCCTGGAGAGGGGTGTGCTGGG + Intronic
969330645 4:6472006-6472028 GGGATGGGGTGGGGTGGGGTGGG + Intronic
969330656 4:6472026-6472048 GGGATGGGGTGGGGTGGGGTGGG + Intronic
969495783 4:7525488-7525510 GGAAGGTGGAGGGCTGGGCTGGG - Intronic
969504522 4:7576558-7576580 GGAATGAATAGGAGTTGGCTGGG + Intronic
970161381 4:13192838-13192860 GGACTGGTGAGGGCTGGGCACGG - Intergenic
970560926 4:17281689-17281711 GAAATGGAGAAGTATGGGCTGGG + Intergenic
971547728 4:27908634-27908656 GGAATGCAAAGGATTGGGCTGGG + Intergenic
971914686 4:32852077-32852099 GGATTGGAGAGGGGTGGCCTTGG + Intergenic
972282215 4:37613457-37613479 GGAATGGGGTGGGATGGGATGGG - Intronic
972766543 4:42156664-42156686 GGAGAGGAGAGAGGCGGGCTGGG + Intergenic
972847811 4:43010585-43010607 AGAATGGATGGGGGTGGGGTGGG + Intronic
973368235 4:49224989-49225011 GGATGGGAGAGGGGTGGGGTTGG - Intergenic
973392811 4:49570436-49570458 GGATGGGAGAGGGGTGGGGTTGG + Intergenic
973772793 4:54222096-54222118 GGCATGGTGAGGGGTGGGAGTGG + Intronic
974120038 4:57627170-57627192 GGAATGCAGTGGTGTGGTCTTGG - Intergenic
975259947 4:72286739-72286761 TGGATGGGGATGGGTGGGCTAGG + Intronic
975592919 4:76017926-76017948 GGAAGGGAGAGGGGTGGCATTGG + Intronic
975962984 4:79935300-79935322 GTAATGGAGAGGGTGGGGGTGGG - Intronic
976168560 4:82280647-82280669 GGAATGCAGTGGCGTGGTCTCGG - Intergenic
976348392 4:84031280-84031302 GGAATGGAGAGTGGGGGGAGTGG - Intergenic
976466307 4:85372853-85372875 TGAATGGAGTGGGGTGCGATGGG + Intergenic
976607823 4:86998979-86999001 GGAATGGAGTGGGTTGGAATTGG + Intronic
976835983 4:89374406-89374428 GGAATGCAGAGGTGTGATCTTGG - Intergenic
978665647 4:111178091-111178113 GGAAGGGAGAGGGGAGGGGAGGG - Intergenic
979166801 4:117543756-117543778 AGAATTGAGAGGGGTGAGCATGG + Intergenic
979509416 4:121535277-121535299 GGAATGGAGAGGTGTGGAGGGGG + Intergenic
979553598 4:122019328-122019350 GGGATGTAGAGGGGTGGGAGTGG - Intergenic
981009393 4:139909784-139909806 GGAATGCAGTGGGGTGATCTCGG - Intronic
981624765 4:146742755-146742777 GGAAAGGAGAGGGGAGGGGAGGG - Intronic
981899312 4:149843473-149843495 GGTATGGAGACTGCTGGGCTAGG - Intergenic
982071770 4:151701700-151701722 AGCATGGAGAGGGGTGGGTTTGG - Intronic
982441248 4:155438786-155438808 GGAATAGAGAGGGGTGGGAAGGG - Intergenic
983545722 4:168961899-168961921 GGAAGGGAGAGGGGAGGGGAGGG + Intronic
983645701 4:169989386-169989408 GTAATTGAGAGCAGTGGGCTTGG - Exonic
983899579 4:173119497-173119519 TGAATGGCAAGGGGTGGGGTTGG - Intergenic
984111775 4:175625971-175625993 GGAGTGCAGTGGGGTGGTCTCGG - Intergenic
984352480 4:178613328-178613350 GGAATGGAGAGGACTGTCCTGGG + Intergenic
984672868 4:182512166-182512188 GCAAGGGAGTGGGGAGGGCTGGG - Intronic
984727494 4:183035756-183035778 GGCATGTAGAGGGGGGGTCTGGG + Intergenic
985331890 4:188846273-188846295 GGAAAGGACAGGGTTGGGGTGGG - Intergenic
1202765338 4_GL000008v2_random:144499-144521 GGATGGGAGAGGGGTGGGGTTGG - Intergenic
985478801 5:94444-94466 AGAGTGAAGAGGGGTAGGCTGGG + Intergenic
985478835 5:94557-94579 AGAGTGAAGAGGGGTAGGCTGGG + Intergenic
985672678 5:1214379-1214401 GGGATGCCCAGGGGTGGGCTGGG - Intronic
985719668 5:1482497-1482519 GGGGTGGGGTGGGGTGGGCTGGG + Intronic
986507195 5:8464499-8464521 GGAGTGCAGTGGCGTGGGCTCGG + Intergenic
986969612 5:13316515-13316537 GGGATGGAGAGGGGTGAGGAGGG + Intergenic
987112457 5:14700665-14700687 GGGCTGCAGAGGGGAGGGCTGGG - Intergenic
987336278 5:16900666-16900688 AGAATGAAGAGGGATGGGGTGGG - Intronic
988601115 5:32640323-32640345 GGAATGGACAGGTGTGAGCTAGG + Intergenic
988614782 5:32764735-32764757 GGAATGGAGTGGCGTGATCTCGG - Intronic
989056579 5:37371328-37371350 GGGAAGGAGAGGGGCGGGATGGG + Intergenic
989175530 5:38521622-38521644 GGTATTGAGAGTGGTGGGCTGGG + Intronic
989201900 5:38772281-38772303 GGCAGGGAGAGGGGTAGGCGAGG + Intergenic
989343260 5:40400839-40400861 GGAATGGAATGGGATGGGATAGG + Intergenic
990073943 5:51819403-51819425 GGAGTGCAGAGGTGTGGTCTCGG - Intergenic
990165487 5:52989268-52989290 GGAATCAGGAGGGGCGGGCTGGG + Intergenic
990446227 5:55896668-55896690 GGAGTGGAGAGGGGAGGGGAGGG - Intronic
990679531 5:58226104-58226126 GGAATGCAGTGGGGTGATCTTGG - Intergenic
991509424 5:67360460-67360482 GGAATGGAGAGGACCTGGCTTGG - Intergenic
991550605 5:67831807-67831829 GGAATGGCGAGTGGGGGGCGGGG + Intergenic
991663497 5:68973771-68973793 GGGATGGGGAGGGGTGGCATCGG - Intergenic
992253754 5:74901115-74901137 GGAATGCAGTGGCGTGGTCTCGG - Intergenic
993410969 5:87572946-87572968 GGAGTGGAGAGGCGTGATCTCGG + Intergenic
993424838 5:87749954-87749976 GGAATATGGAGGTGTGGGCTAGG + Intergenic
994575662 5:101575579-101575601 GTGATGGAAAGGGGCGGGCTAGG - Intergenic
994616310 5:102108159-102108181 GGGTTGGGGAGGGGTGGACTTGG + Intergenic
994817877 5:104607627-104607649 GGAATGGGGTGGGGTGGGGGAGG + Intergenic
995044284 5:107626884-107626906 GGAATGGTCTGGGGTGGTCTAGG - Intronic
995096242 5:108239331-108239353 GGGATGCAGAGGGGTGGTGTTGG - Intronic
995367313 5:111377505-111377527 AGAATGGAGGGGGGTGGGGGTGG + Intronic
996117118 5:119631298-119631320 GGCATGGAGAGCAGGGGGCTGGG + Intronic
996347128 5:122499294-122499316 GGAAAGGGGAGGGCTGGTCTGGG - Intergenic
996484031 5:124010426-124010448 GGAATGGAGAGTCTTGGCCTAGG + Intergenic
997143880 5:131411340-131411362 GGAATGCAGTGGCGTGGTCTTGG - Intergenic
997320177 5:132971500-132971522 GGAATGCAGTGGCGTGAGCTTGG - Intergenic
997460579 5:134049382-134049404 GGAATAGCAAGGGGTGGGCATGG - Intergenic
997948282 5:138221532-138221554 AGAAGGGAGAGGGCTGGGCGTGG + Intergenic
998266110 5:140669008-140669030 GGGATGGAGGGGTGTGTGCTGGG + Intronic
998391407 5:141789149-141789171 GGAAGGGAGAGGGGTGAGGGTGG - Intergenic
998838631 5:146229469-146229491 AGTATGGGGAGGGGTGGGCAGGG - Intronic
999432659 5:151537432-151537454 GGAAAGGAGAGGGGAGGGGAGGG + Intronic
999974466 5:156897055-156897077 GGAATGCAGTGGTGTGAGCTCGG - Intergenic
1000075340 5:157779324-157779346 GGAATGGAGGAGAGAGGGCTGGG + Intergenic
1000441633 5:161270742-161270764 GGCATGGAGAGAGGGGGGCCAGG + Intergenic
1001544004 5:172558768-172558790 GGGATGGAGAAGGGGGAGCTCGG + Intergenic
1001761212 5:174209943-174209965 GGGGTGAAGAGGGGTGAGCTGGG + Intronic
1001761219 5:174209964-174209986 GGGGTGAAGAGGGGTGAGCTGGG + Intronic
1001761226 5:174209985-174210007 GGGGTGAAGAGGGGTGAGCTGGG + Intronic
1001766834 5:174255708-174255730 GGAAGGGAGGAGGGTGGGGTTGG + Intergenic
1001939351 5:175729598-175729620 GGAGTGGGGAGCGGTGGGCGGGG - Intergenic
1002106524 5:176881932-176881954 GGCAAGCAGAGGTGTGGGCTGGG - Exonic
1002270320 5:178067447-178067469 GGGAAAGAGATGGGTGGGCTGGG + Intergenic
1002345018 5:178542695-178542717 GGAAGGGGGAGGGGAGGGCTGGG + Intronic
1002471721 5:179439505-179439527 GGCCTGGAGTGGGGTGGCCTGGG - Intergenic
1002577288 5:180181472-180181494 GGAGTGGAGTGGAGTGGGGTGGG + Intronic
1002697589 5:181100943-181100965 GGGGTGGGGAGGGGTGGGCAGGG - Intergenic
1003414980 6:5899250-5899272 GGAAAGGGTATGGGTGGGCTGGG - Intergenic
1004113920 6:12749020-12749042 GGAGTAGAGAGGGCTGGGCTGGG + Intronic
1004190976 6:13463193-13463215 GGAATGCAGAAGGGTGGGGCTGG + Intronic
1004691256 6:17994040-17994062 GGAATGCAGTGGCATGGGCTTGG - Intergenic
1005642164 6:27806931-27806953 GGAAACTAGAGGGGTGGGCGCGG - Intergenic
1005964890 6:30720327-30720349 AGAAAGGAGAGGGGAGGGCGCGG - Exonic
1005987994 6:30885949-30885971 GGAGTGGAAGGGGGTGGGATTGG + Intronic
1006184786 6:32175677-32175699 GGAAAGGAGAGGGGCCGACTGGG - Intronic
1006255087 6:32826322-32826344 TGAATGGAGAGGGGAAAGCTTGG - Intronic
1006288145 6:33113714-33113736 GAACTGGAGAGGGGTGAGGTTGG + Intergenic
1006295065 6:33166654-33166676 GGGGTGGAGAGGGGTGGAGTTGG - Intronic
1006298039 6:33178775-33178797 GCAGTAGGGAGGGGTGGGCTTGG - Intronic
1006303683 6:33207163-33207185 AGAAAGGAGAGGGGTGGGGGAGG - Intergenic
1006333034 6:33405659-33405681 GAAATGGGGAGGAGTGGGCAGGG + Intronic
1006720942 6:36150598-36150620 GGAAGGGAGAGGGGTGAGGGGGG - Intergenic
1006738816 6:36293138-36293160 GGCATGGTGAGGGGTGAGATGGG + Intronic
1006898317 6:37484479-37484501 GGGTTGGGGTGGGGTGGGCTGGG + Intronic
1007293083 6:40801741-40801763 GGAATGGAAGGGCGTGTGCTTGG + Intergenic
1007369996 6:41420473-41420495 GGGATGGAGAAGGGTAGGCTTGG + Intergenic
1007399292 6:41594727-41594749 GCAGGGGAGGGGGGTGGGCTGGG - Intronic
1007666449 6:43516436-43516458 GGCATGGAGTGGGGTTGGGTGGG - Intronic
1007835788 6:44672541-44672563 GGATGGGGTAGGGGTGGGCTGGG + Intergenic
1007848231 6:44778796-44778818 AGAAGCGAGAGGGGTGGGTTTGG + Intergenic
1007941353 6:45784569-45784591 GGGATGGAGAGGGTTTGGGTTGG + Intergenic
1008857760 6:56112495-56112517 GGAAGGGGGAGGGGTGGCATCGG - Intronic
1010022893 6:71181727-71181749 GGAATGCAGTGGGGTGGGTGAGG + Intergenic
1010426584 6:75734729-75734751 GGGATGGAGAGGGGTGTGAGAGG + Intergenic
1011419329 6:87155391-87155413 GGAAAGGAGAAGGGCGGGGTTGG - Intronic
1011597510 6:89030121-89030143 GGACTGGGGAGGGGAGGGGTAGG - Intergenic
1011857526 6:91713239-91713261 GAAAAGGAGAGGGGAGGACTGGG - Intergenic
1012330684 6:97982013-97982035 GGAGAGAAGAAGGGTGGGCTAGG - Intergenic
1013449821 6:110269069-110269091 GGAATGGAGAGGCTTGGGGTGGG - Intronic
1014069924 6:117169067-117169089 GGCAGGGAGAGGGGAGAGCTTGG - Intergenic
1015444602 6:133288405-133288427 GGAAGGGCAAGGGGTGGACTTGG + Intronic
1015710029 6:136129482-136129504 GGAGTGGGGAGGGGTGTGGTTGG - Intronic
1016132965 6:140500198-140500220 TGAATTGAGAGGGGCTGGCTAGG + Intergenic
1016503538 6:144750164-144750186 GGAAGGAGGAGGGGTGGGTTAGG - Intronic
1016811084 6:148261858-148261880 GGCATGGTGGGGGATGGGCTTGG + Intergenic
1017121076 6:151024490-151024512 GGAATGCAGTGGGGTGATCTTGG - Intronic
1017239677 6:152153340-152153362 GGGATGGACATGGGTGTGCTGGG - Intronic
1017813513 6:158000927-158000949 TGAATGGAGAGGTGTGGTCAAGG - Intronic
1018680826 6:166263395-166263417 GGAATGGAGGTGGGAGGGCTTGG + Intergenic
1018807964 6:167275974-167275996 GGTAGGGAGAGGGGAGGGGTAGG - Intronic
1018908160 6:168087116-168087138 GGAATGCAGTGGTGTGGGCTTGG + Intergenic
1019190477 6:170247897-170247919 GGTGTGGACAGGAGTGGGCTTGG - Intergenic
1019405442 7:881339-881361 GGGATGGGGTGGGGTGGGGTGGG - Intronic
1019509828 7:1412294-1412316 AGGTTGGAGAGGGGTGGGCATGG - Intergenic
1019548989 7:1592937-1592959 GGCGTGGAGAGGGGGCGGCTGGG + Intergenic
1019967243 7:4509754-4509776 GGAATGCAGTGGGGTGAACTTGG - Intergenic
1020202827 7:6093621-6093643 GGAAAGGAGAGGGGAGGGGTGGG - Intergenic
1020981475 7:15074924-15074946 GAAATGGATAGGGCTGGGCACGG + Intergenic
1020993618 7:15233498-15233520 GGAATGGGGAGAGGTGGACTAGG + Intronic
1021586711 7:22216384-22216406 GGAATGGAGAGGGGTGGGCTGGG - Intronic
1021827666 7:24571745-24571767 GAAATGAAGTGGAGTGGGCTCGG - Intergenic
1021914930 7:25421932-25421954 TGATTGGTGAGAGGTGGGCTTGG - Intergenic
1022527745 7:31049417-31049439 GGGGTAGAGTGGGGTGGGCTGGG + Intergenic
1022800241 7:33769946-33769968 GGAATGGCTAGGGATGGGGTTGG + Intergenic
1023272575 7:38480535-38480557 GGACTGGTGAGAGGTGGGTTGGG + Intronic
1023732234 7:43203157-43203179 GGCAAGGAGAGGGCTGGGCATGG - Intronic
1023752404 7:43385216-43385238 GGAGGGGAGAGGGGAGGGGTGGG - Intronic
1023837481 7:44076828-44076850 GGAGAGGAGAGGGGTGTGCGTGG - Intronic
1023911248 7:44558478-44558500 GGAAAGGAGAGGGGAGGGGAGGG - Intergenic
1024278315 7:47697307-47697329 GGAGTGGAGAGGTGTGATCTTGG + Intronic
1024425226 7:49217090-49217112 GGAAAGGAAAGTGCTGGGCTGGG + Intergenic
1024587994 7:50857635-50857657 GGAATGGAGAGAGGGGGACTTGG - Intergenic
1024725469 7:52189381-52189403 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
1024725497 7:52189448-52189470 GGAAGGGAGAGGGGAGGGAAAGG + Intergenic
1025268404 7:57486396-57486418 GGAATGGAGAGGAGTGGAGTGGG + Intergenic
1025268506 7:57487497-57487519 GGAATGGAGAGGAATGGAATGGG + Intergenic
1025268664 7:57488725-57488747 GGAATGGAGAAGAGTGGAATGGG + Intergenic
1025268760 7:57489583-57489605 GGAATGGAGAGGAATGGAATGGG + Intergenic
1025268847 7:57490184-57490206 GGAATGGAGAGGAATGGAATGGG + Intergenic
1025268925 7:57490861-57490883 GGAATGGAGTGGAATGGACTCGG + Intergenic
1025269505 7:57496154-57496176 GGAATGGTGAGGGATGGATTGGG + Intergenic
1025269555 7:57496432-57496454 GGAATGGAGAGGAATGGAATGGG + Intergenic
1026545206 7:71316299-71316321 AGAATGGAACAGGGTGGGCTGGG + Intronic
1026846271 7:73700635-73700657 AGAAGGGAGAGAGGTGGGATGGG + Intronic
1026849724 7:73717286-73717308 GGACTGGGGCGGGCTGGGCTGGG - Intronic
1026857329 7:73763342-73763364 GGAAAGGAGAGGGGAGGGGAAGG - Intergenic
1027642617 7:80756055-80756077 GGAGTAGAGAGGAGTGGCCTGGG - Intronic
1028039893 7:86038416-86038438 GTAATGGAGGGTGGTGGGCAGGG - Intergenic
1028775335 7:94669733-94669755 GGAATGGGGTGGGGTAGGGTGGG + Intergenic
1028941478 7:96526719-96526741 AGAAAGGAGAGGGGAGGGCTTGG - Intronic
1029105078 7:98168165-98168187 GGGCTGGGGAGGGGAGGGCTGGG + Intronic
1029403735 7:100360666-100360688 GGAATGGCCAGAGGTGGGCCAGG + Intronic
1029406237 7:100375439-100375461 GGGATGGTGAGGGATGGGCATGG + Intronic
1029506635 7:100967027-100967049 GGCAGGGAGGGGGCTGGGCTCGG + Intronic
1029699256 7:102235752-102235774 GGACGGGGGTGGGGTGGGCTGGG - Intronic
1029910850 7:104145817-104145839 GGATTGGAAAGTGCTGGGCTTGG - Intronic
1029989029 7:104946240-104946262 GGAATGCAGTGGGGTGATCTCGG - Intergenic
1030612290 7:111702942-111702964 GGAATGCAGTGGCGTGGTCTCGG + Intergenic
1032020126 7:128403086-128403108 GGCCTGGGAAGGGGTGGGCTTGG - Intronic
1032164035 7:129531818-129531840 GTAAAGGAGTGGGGTGGGCCAGG - Intergenic
1032597157 7:133253246-133253268 GGAAGGGAGAAGGGTTAGCTGGG + Intronic
1032797468 7:135289271-135289293 GGAGTGAGGAGGGCTGGGCTGGG - Intergenic
1032824192 7:135553377-135553399 GGAATGGCTAAGGGTTGGCTAGG + Intergenic
1032901140 7:136310156-136310178 GGAGTGGAGTGGTGTGGTCTCGG + Intergenic
1033169862 7:139073953-139073975 GGAGTGGAGAGGCGTCGGATGGG + Exonic
1033210671 7:139457756-139457778 GGAATGGAGTGGGTGGGTCTAGG - Intronic
1033656740 7:143380551-143380573 GGAATGGAGGTGGGAGGGCGGGG - Intergenic
1033922178 7:146407804-146407826 GGAGTGGAAAGAGGAGGGCTTGG - Intronic
1033969760 7:147025299-147025321 GGATAGGAGAGGGGAGGGGTGGG + Intronic
1034196808 7:149254440-149254462 GGGATGGAGGGGGGTGGCATTGG + Exonic
1034272490 7:149810022-149810044 GGAGTGGAGTGGAGTGGGCTGGG + Intergenic
1034339354 7:150341784-150341806 GGGAAGGAGGGGGGTGGGATGGG - Intergenic
1034434280 7:151055708-151055730 GGAATGGAGAGGCTGGGGCCAGG - Intronic
1034896137 7:154877733-154877755 GGAATGGGCAGGGGAGGGCCAGG - Intronic
1034947590 7:155273341-155273363 GGAATGGACAGGGGTGGACCAGG + Intergenic
1035265631 7:157689118-157689140 GGAGCGCAGAGGGGTGTGCTTGG + Intronic
1035385349 7:158468643-158468665 TGAATAGAGAGGGGTGCGCAGGG + Intronic
1035477497 7:159153629-159153651 GGAGGGGAAAGGGGAGGGCTTGG - Intergenic
1035726394 8:1826976-1826998 GCAGTGGAAAGGGGTGGGCCAGG + Intronic
1035907567 8:3530570-3530592 GGAATGCAGGGGTGTGAGCTAGG + Intronic
1036476938 8:9102070-9102092 TGAGTGGAGAGGGTTGGGGTGGG + Intronic
1036530340 8:9579517-9579539 GGAATGCAGTGGCGTGGTCTCGG + Intronic
1036591705 8:10174346-10174368 GGCATGGCTAGGGGTGGACTCGG + Intronic
1036704250 8:11034830-11034852 TGGATGGAGATGGGTGTGCTGGG - Intronic
1036899513 8:12660238-12660260 GGGATGGAGCGTGGTGGGCAAGG + Intergenic
1036900577 8:12666385-12666407 GGGATGGAGCGTGGTGGGCAAGG + Intergenic
1037004373 8:13759345-13759367 GGGATGGGGAGGGGTGGGGAGGG - Intergenic
1037604132 8:20423045-20423067 GGAAGGGGGTGGGGTGGGGTGGG + Intergenic
1037730126 8:21517251-21517273 GGGATGGAGAGGGTCGGGATAGG - Intergenic
1037753498 8:21697203-21697225 GGAAAGGGGAGGGGAGGGCATGG + Intronic
1037767412 8:21780663-21780685 AGAGTGGAGAGGGGAGGGCAGGG - Intronic
1037885529 8:22594205-22594227 GGGAAGGAGAGGGGTGGGCCAGG + Exonic
1039407596 8:37326610-37326632 GGGAAGGAGAGGGGAGGGCAGGG - Intergenic
1039559745 8:38503669-38503691 AGGAGGGAGAGGTGTGGGCTGGG - Intergenic
1039564673 8:38542508-38542530 GGAATGGAGAGGGGGAGGGGAGG - Intergenic
1039569061 8:38572557-38572579 GGAGTGTAGAGGGGTGGGACAGG - Intergenic
1039612057 8:38927938-38927960 GGAATGGAGAGTGGGGGGGCAGG + Intronic
1039904866 8:41779175-41779197 GGATAGGAGAGGGATGGGTTGGG - Intronic
1040017260 8:42709679-42709701 GGAATGCAGAAGGGTGATCTTGG + Intronic
1040355579 8:46614918-46614940 GGGATGGAGAGAGTGGGGCTGGG - Intergenic
1040470631 8:47733334-47733356 GGAATGGAGTGGTGTGAGCTTGG - Intronic
1041940121 8:63377775-63377797 GGGATAGAGAGGAGTGGGGTAGG - Intergenic
1042026542 8:64430110-64430132 GTGTTGGAGAGGGGTGGGGTGGG - Intergenic
1042537153 8:69870484-69870506 GGCATGGTGAGGGATGGCCTTGG + Intergenic
1043467849 8:80530512-80530534 GGAAGGGAGAGAGGAGTGCTTGG + Intergenic
1043708524 8:83382486-83382508 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
1044662044 8:94600944-94600966 GGAAAGGAGAGGGGAGGGAAGGG + Intergenic
1044666825 8:94640801-94640823 TGAATGGAGAGGCGAGGGCAGGG - Intergenic
1044695374 8:94917058-94917080 GGAGTGCAGAGGTGTGGTCTCGG - Intronic
1045101390 8:98848184-98848206 GGAATTGAGAGGTGAGTGCTAGG - Intronic
1046588319 8:116175301-116175323 GGAAGGGAGTGGGGTGGGAGTGG + Intergenic
1047214201 8:122863591-122863613 GGAAAGGAGAGGGATGGGAGGGG + Intronic
1047435081 8:124829457-124829479 GGAGTGCAGTGGGGTGAGCTCGG + Intergenic
1048105789 8:131407802-131407824 GGAATGGGGAGAGGTGGGGATGG - Intergenic
1048462987 8:134638402-134638424 GGAATTAAGAGGGGTGAGCGGGG + Intronic
1048952298 8:139506375-139506397 GGAGTGGGGAGAGGTGGGTTGGG + Intergenic
1049090761 8:140511845-140511867 GGAGCGGCGAGGGGTGGGCGGGG - Intronic
1049217786 8:141415712-141415734 GGACTGGGGTGGGGTGGGGTGGG + Intronic
1049240241 8:141534007-141534029 GGGCTGGATTGGGGTGGGCTGGG + Intergenic
1049321874 8:142001026-142001048 GGAAGGAAGAGGGGTGCTCTTGG + Intergenic
1049487522 8:142874294-142874316 GGAGAGAAGAGGGGTGGCCTGGG + Exonic
1049536661 8:143185793-143185815 GGAGTGGACAGGGGAGGGCAGGG - Intergenic
1049575045 8:143386040-143386062 GGAGTGGGGAGGGGTGGGGGCGG + Intergenic
1049866438 8:144941022-144941044 TGACTGGAGAGGGGAGGGGTTGG + Intronic
1051190428 9:14505679-14505701 GGTAGGGAGAAGGGTGGGATTGG + Intergenic
1051210127 9:14732528-14732550 GGAATGCAGCGGTGTGGTCTTGG - Intergenic
1051220457 9:14843285-14843307 GGAGTGGAGAGGGGTGAGTGGGG - Intronic
1051833352 9:21306592-21306614 GGAGTGCAGTGGGGTGGTCTCGG - Intergenic
1051907980 9:22118324-22118346 GGAGTGGAGTGGGGTGGGGCAGG - Intergenic
1052262950 9:26539166-26539188 GGAATGGAGAGGAACTGGCTAGG + Intergenic
1052325414 9:27212473-27212495 GGAATGGAGAGGGGGTGGGAAGG + Intronic
1052344580 9:27396386-27396408 GGGGTGGATAGGAGTGGGCTTGG - Intronic
1052851003 9:33378357-33378379 GGAATGGCGAGGGTTGGGGAGGG + Intergenic
1052951884 9:34219881-34219903 GGAAGGGAGAGGGGAGGGGAAGG - Intronic
1053130688 9:35613550-35613572 GCAATGGAGAGAGGTGGCCTGGG - Intronic
1053173746 9:35908185-35908207 GGGATGGAGGGGGCTGGGCTAGG - Intergenic
1053275463 9:36780244-36780266 GGGATGGAGAGGAGAGAGCTGGG + Intergenic
1053663637 9:40301938-40301960 GGATGGGAGAGGGGTGGGGTTGG + Intronic
1053914151 9:42932480-42932502 GGATGGGAGAGGGGTGGGGTTGG + Intergenic
1054375761 9:64448171-64448193 GGATGGGAGAGGGGTGGGGTTGG + Intergenic
1054520978 9:66074347-66074369 GGATGGGAGAGGGGTGGGGTTGG - Intergenic
1055044732 9:71911903-71911925 GGAAATGAGAGGAGTCGGCTGGG + Intronic
1055372211 9:75612080-75612102 GGAGTGGAGAGGAGTGGACTAGG + Intergenic
1055378546 9:75679701-75679723 GGAAAGGGGAGGGGAGGGCAGGG + Intergenic
1056064832 9:82923383-82923405 GGAATGGAGGGGGTGGGGGTGGG - Intergenic
1056167991 9:83956966-83956988 GGAAAGGAGAGGGGTGGGAGCGG - Intronic
1057029010 9:91759364-91759386 TGAATGGAAAAGGGTTGGCTAGG - Intronic
1057130818 9:92653391-92653413 GGAATGGACAGGGGTGGTGGTGG - Intronic
1057436611 9:95045881-95045903 GGAATGGAGAGTGGTGTTCGGGG + Intronic
1057837168 9:98454771-98454793 AGGATGGAGAGGGGTGGGAAGGG - Intronic
1058445170 9:105048908-105048930 GGAATGCAGGGGGGTGATCTCGG + Intergenic
1058642221 9:107098861-107098883 GGGATGAGGATGGGTGGGCTGGG - Intergenic
1058681251 9:107442206-107442228 GGAATGCAGTGGCGTGGTCTCGG - Intergenic
1058788215 9:108413031-108413053 GGAATGTAGAAGGGTGGGTTTGG + Intergenic
1058886015 9:109321332-109321354 GAAAAGGAGAGGGGTGGACTAGG + Intergenic
1058917749 9:109584138-109584160 GGAGTGCAGAGGCGTGGTCTTGG + Intergenic
1058968361 9:110057666-110057688 GAAAAGGAGAGGGCTGGGCGTGG - Intronic
1059020813 9:110574794-110574816 GGAATGCAGTGGTGTGGCCTCGG + Intronic
1059187681 9:112290619-112290641 GGAATGCAGTGGCGTGGTCTCGG - Intronic
1059303077 9:113331155-113331177 GGAGTGGATGGGGGTGGGGTGGG + Intronic
1059400334 9:114065638-114065660 GGAATGGTGAGGGTGGGGGTGGG - Intronic
1059676792 9:116547971-116547993 GGAGTGGAGACAGGTGGGCAGGG - Intronic
1060758239 9:126227928-126227950 GGCAGGGGGAGGGGCGGGCTGGG + Intergenic
1060840554 9:126789865-126789887 GGCAGGAAGATGGGTGGGCTGGG + Intergenic
1060869849 9:127030764-127030786 AGAAGGCAGAGGGGTGGGATGGG + Intronic
1061080272 9:128365615-128365637 AGGATGGAGTGGGGTAGGCTTGG + Intergenic
1061133943 9:128722899-128722921 GGAATGGACAGGGGGCTGCTGGG + Intronic
1061172659 9:128969702-128969724 GGAATGCAGTGGCGTGGTCTTGG + Intronic
1061414734 9:130440627-130440649 GGAATGCAGCGGCGTGGTCTCGG - Intergenic
1061449211 9:130659616-130659638 GGAGGGGACAGGGGTGGGGTGGG + Intergenic
1061464774 9:130769024-130769046 GGAATGGATCGGGGTGGGTATGG + Intronic
1061683412 9:132256050-132256072 GGAATGGAGTGGCGTGATCTCGG - Intergenic
1061821708 9:133231611-133231633 GAAGTGGAAAGGGGTGGGCAGGG + Intergenic
1061875629 9:133542189-133542211 GCACTGGAGAGGGTGGGGCTTGG + Intronic
1061946303 9:133910108-133910130 GCAATAGAGAGGGCTGGGGTGGG - Intronic
1062237546 9:135518486-135518508 GAAGTGGAAAGGGGTGGGCAGGG - Intergenic
1062321043 9:135990731-135990753 GGCGTGGAGAGGGGAGGGCTGGG - Intergenic
1062384113 9:136302339-136302361 GGAAGGGTGAGGGGTGGGAGGGG - Intronic
1062532857 9:137009338-137009360 GGCAGGGCCAGGGGTGGGCTGGG - Intronic
1062586190 9:137251055-137251077 GGGAGGGAGAGGGCTGGGCCAGG + Intergenic
1062586544 9:137252282-137252304 GGCCTGGAGAGAGGAGGGCTAGG + Intronic
1203726024 Un_GL000216v2:50216-50238 GGAATGGAAAGGAATGGACTGGG - Intergenic
1203726378 Un_GL000216v2:52989-53011 GGAATGGAATGGAGTGGACTCGG - Intergenic
1203730032 Un_GL000216v2:81948-81970 GGAATAGAAAGGGATGGACTGGG - Intergenic
1203385417 Un_KI270438v1:46430-46452 GGAATGGAGTGGGGTGGATTGGG + Intergenic
1203344764 Un_KI270442v1:25886-25908 GGAATGGAGTGGAGTGGGATGGG + Intergenic
1203345978 Un_KI270442v1:34524-34546 GGAATGGAAAGGAGTGGAGTGGG + Intergenic
1203345979 Un_KI270442v1:34529-34551 GGAAAGGAGTGGAGTGGGATAGG + Intergenic
1203350543 Un_KI270442v1:77960-77982 GGAATTGAAAGGGGTGGAGTGGG + Intergenic
1203546087 Un_KI270743v1:129388-129410 GGATGGGAGAGGGGTGGGGTTGG - Intergenic
1203653277 Un_KI270751v1:150128-150150 GGAATGGAGTGGGGTGGAGTGGG - Intergenic
1203674764 Un_KI270756v1:12604-12626 GGAATGGAAAGGAATGGACTTGG - Intergenic
1185459793 X:328797-328819 GGCAGGGAGAGGGGAGGGCAGGG - Intergenic
1185598614 X:1323961-1323983 GGAATGCAGTGGGGTGATCTTGG - Intergenic
1185598852 X:1325374-1325396 GGAAAGGAGAGGGGAGGGGAGGG + Intergenic
1185779085 X:2829665-2829687 GGAGTGGAGAGGGGTGACCGGGG + Intronic
1186715293 X:12244895-12244917 GGAGAGGAGAGGGGTGGCATAGG + Intronic
1189104029 X:38219170-38219192 AGAAAGGAGAGGGGAGGGCAGGG + Intronic
1189147314 X:38668242-38668264 TGACTGGAGAGGGGTGGGAGAGG + Intronic
1189398921 X:40647249-40647271 GGGATGAGGAGGGGTGGGGTGGG + Intronic
1189555809 X:42144139-42144161 GGAATGGAAAGGGAGGGGCTGGG + Intergenic
1189724794 X:43957555-43957577 TGAATGGAGAGTGGAGGGATTGG + Intronic
1189831002 X:44972982-44973004 GGAATGCAGTGGGGTGATCTTGG - Intronic
1190061552 X:47214955-47214977 GGTGTGGAGAGGGGTGGACAAGG - Exonic
1190258843 X:48785770-48785792 GGAAAGGAAAGGGGTGGAGTGGG - Intergenic
1190808495 X:53861740-53861762 GGATGGGAGAGGGGTGGTGTGGG + Intergenic
1190880022 X:54485264-54485286 GGAAAGGAGAAGAGAGGGCTTGG - Intronic
1191761863 X:64655210-64655232 GGAATTGAGAGTGGTGGTTTGGG - Intergenic
1191842737 X:65524745-65524767 GGAATGGGGTGGGGTGGGATGGG - Intronic
1191851514 X:65589199-65589221 GGACTGGGGTGGGGTGGGGTGGG - Intronic
1192156700 X:68752133-68752155 GGCATGGACAGGGCTGGGCCTGG + Intergenic
1192268710 X:69558160-69558182 GGAATGGAGATGGCTGCGATGGG + Intergenic
1192360243 X:70434588-70434610 AGAAAGGAAAGGGGTGGGCCCGG - Intergenic
1192429824 X:71104250-71104272 GGTAGGGAGAGGGGGGTGCTGGG + Intronic
1192490159 X:71569539-71569561 GGAATGCAGTGGGGTGATCTTGG + Intronic
1192589910 X:72351148-72351170 GGAATGCAGTGGTGTGGGCATGG + Intronic
1192679827 X:73241163-73241185 GGATGGGAGAGGGGTGGTTTTGG - Intergenic
1193681711 X:84528067-84528089 GGAATGGAGAGGAGAGAGGTAGG + Intergenic
1194411274 X:93561719-93561741 GGAAGGGAGAGAGGTGGGAGAGG - Intergenic
1194783962 X:98058691-98058713 GGATGGGAGAGGGGTGGCATTGG + Intergenic
1195486615 X:105415274-105415296 GGAATGGAGTGTGGTGGAGTAGG + Intronic
1195612207 X:106880551-106880573 GGGATGGAGAGAGATGGGTTAGG + Intronic
1196288855 X:113915419-113915441 TCAATGGAGAGGGGAGGGCAGGG - Intergenic
1196830751 X:119773658-119773680 GGGATGGAGAGGAGTAGGCTAGG + Intergenic
1197198839 X:123731887-123731909 GAAATGGAGAGGGGTGGGCAAGG + Intronic
1197905013 X:131415363-131415385 AGAATGGAGAAGGGAGTGCTGGG - Intergenic
1198276146 X:135097736-135097758 GGAATGGAAGGTAGTGGGCTGGG - Intergenic
1198310368 X:135423005-135423027 GGAATGGAGGGTAATGGGCTGGG + Intergenic
1199115340 X:143985458-143985480 GAGATAGAGTGGGGTGGGCTGGG + Intergenic
1199155267 X:144539402-144539424 GAAATGTAAAGGGGTGGGGTTGG - Intergenic
1199435123 X:147804474-147804496 GGAAGGGAAAGGGGTGGGGGAGG + Intergenic
1199979156 X:152911611-152911633 GGGATGGGGCGGGGTGGGGTGGG - Intergenic
1200106179 X:153714170-153714192 GTATGGGGGAGGGGTGGGCTGGG - Intronic
1200766796 Y:7086813-7086835 GGAGTGCAGTGGGGTGGTCTTGG - Intronic
1200828097 Y:7663678-7663700 GGGATGGAGTGGGGAGGGATGGG + Intergenic
1200842437 Y:7796459-7796481 GGAAAGGAGAGGGGAGGGGAGGG - Intergenic
1201096764 Y:10627486-10627508 GGAATGGAGTGGGATGGAATGGG - Intergenic
1201104984 Y:10756788-10756810 GGAATGGTGTGGGGTGTGGTGGG - Intergenic
1201109739 Y:10790447-10790469 GGAGTGGAGTGGGGTGGAGTGGG - Intergenic
1201109845 Y:10791199-10791221 GGAATGGAAAGGAATGGGATGGG - Intergenic
1201112374 Y:10808976-10808998 GGAATGGAGTGGAGTGGAGTGGG - Intergenic
1201112489 Y:10810514-10810536 GGAATGGAGAAGAGTGGGGTGGG - Intergenic
1201114189 Y:10823048-10823070 GGAATGGAGTGGAGTGGAATGGG - Intergenic
1201115074 Y:10829196-10829218 GGAATGGAGTGGATTGGGGTGGG - Intergenic
1201118956 Y:10858301-10858323 GGAATGGAGTGGAGTGTGGTAGG - Intergenic
1201120064 Y:10866085-10866107 GGAATGGAGAGGAATGGAATTGG - Intergenic
1201122207 Y:10881838-10881860 GGAATGGAGTGGAGTGGAGTGGG - Intergenic
1201122285 Y:10882353-10882375 GGAATGGAGTGGAATGGGGTGGG - Intergenic
1201124311 Y:10899627-10899649 GGAATGGAGAGGAGTGGAATGGG - Intergenic
1201124508 Y:10900972-10900994 GGAGTGGAGAGGTGTGGAATGGG - Intergenic
1201129483 Y:10941820-10941842 GGAATGGAGTGGAGTGGTGTTGG - Intergenic
1201130019 Y:10945314-10945336 GGAATGGAGTGGAGTGGAATGGG - Intergenic
1201132429 Y:10963251-10963273 GGAGTGGAGAGGAGTGGAGTGGG - Intergenic
1201132894 Y:10968252-10968274 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201133130 Y:10969892-10969914 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201133205 Y:10971033-10971055 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201133307 Y:10971685-10971707 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201133495 Y:10973046-10973068 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201134311 Y:10978937-10978959 GGAATGGGGAGGAGTGGAGTGGG - Intergenic
1201136072 Y:10991088-10991110 GGAATGGAGTGGAGTGGAATGGG - Intergenic
1201137295 Y:10999652-10999674 GGAATGGAGAGGATTGGAATGGG - Intergenic
1201137447 Y:11000666-11000688 GGAATGGAGAGGAATGGGATTGG - Intergenic
1201138415 Y:11008212-11008234 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201138448 Y:11008454-11008476 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201139599 Y:11017562-11017584 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201139681 Y:11018116-11018138 GGAGTGGAGTGGAGTGGGATGGG - Intergenic
1201139799 Y:11018885-11018907 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201140864 Y:11026947-11026969 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201141355 Y:11031359-11031381 GGAATGAAGAGGAGTGGAGTGGG - Intergenic
1201141361 Y:11031394-11031416 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201141370 Y:11031434-11031456 GGACTGGAGAGGAGTGGAGTGGG - Intergenic
1201142513 Y:11040535-11040557 GGAATGGAGAGGAATGGAATGGG - Intergenic
1201174615 Y:11300666-11300688 GGAATGGAAAGGGATGGAATGGG - Intergenic
1201213564 Y:11702506-11702528 GGAATGGAATGGGATGGGATGGG + Intergenic
1202622698 Y:56829754-56829776 GGAATGGAGAGGAATGGAATGGG - Intergenic
1202622849 Y:56830768-56830790 GGAATGGAGAGGAATGGAATGGG - Intergenic
1202623292 Y:56833656-56833678 GGAATGGAGAGGAATGGAATAGG - Intergenic